G286940



Basic Information


Item Value
gene id G286940
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000072
NCBI id null
chromosome length 5473029
location 4305299 ~ 4305518 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU325278
AGCATGGAGTGCATGAAAGAGCTTAGCCTGATGTTATATAAACAACAAGGGCCAAGGGTGGTCTGCACACACCTGGAGGGGCCTGGACCTTTCAGGAGAGAGTACAGGAATCATGTTCTAACATTAATAAGCTCAGAGTGGAAAATATGAGGGAGGCATCTGAGGAGAAAGTATACAGGCGATCTGAGGCAGGGCTGGATCAGAGAGAGCCTGATGTGAG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU325278 True 220 lncRNA 0.49 1 4305299 4305518

Neighbor


gene id symbol gene type direction distance location
CI01000072_04284927_04303593 PPP2R1A, PPP2R1B, PDGFB, PPP2R1B.S coding downstream 1706 4284426 ~ 4303593 (-)
CI01000072_04207000_04210775 NA coding downstream 94221 4206961 ~ 4211078 (-)
CI01000072_04197826_04201434 NA coding downstream 103865 4197826 ~ 4201434 (-)
CI01000072_04191370_04195085 NA coding downstream 110214 4191370 ~ 4195085 (-)
CI01000072_04156907_04167270 NA coding downstream 138029 4156907 ~ 4167270 (-)
CI01000072_04315603_04316880 NA coding upstream 9393 4314911 ~ 4316880 (-)
CI01000072_04514012_04539785 NA coding upstream 207260 4512778 ~ 4539876 (-)
CI01000072_04577347_04600719 UBASH3BB coding upstream 271531 4577049 ~ 4600719 (-)
CI01000072_04602970_04610481 GKUP coding upstream 297331 4602849 ~ 4610481 (-)
CI01000072_04613981_04618187 USF1 coding upstream 307922 4613440 ~ 4618187 (-)
G286937 NA non-coding downstream 28037 4277003 ~ 4277262 (-)
G286936 NA non-coding downstream 28430 4276560 ~ 4276869 (-)
G286883 NA non-coding downstream 35285 4269022 ~ 4270014 (-)
G286880 NA non-coding downstream 211974 4093110 ~ 4093325 (-)
G286877 NA non-coding downstream 224086 4080982 ~ 4081213 (-)
G286945 NA non-coding upstream 4160 4309678 ~ 4309912 (-)
G286948 NA non-coding upstream 14038 4319556 ~ 4319768 (-)
G286953 NA non-coding upstream 26366 4331884 ~ 4338077 (-)
G287023 NA non-coding upstream 108019 4413537 ~ 4414351 (-)
G287059 NA non-coding upstream 114679 4420197 ~ 4420415 (-)
CI01000072_03972493_03983836 SPA17 other downstream 329232 3972401 ~ 3983836 (-)
G286005 NA other downstream 1305804 2993769 ~ 2999495 (-)
G285752 NA other downstream 2134641 2168048 ~ 2170658 (-)
G285766 NA other downstream 2296990 2005551 ~ 2008309 (-)
CI01000072_01596829_01610605 NA other downstream 2677404 1594111 ~ 1627895 (-)
G287021 NA other upstream 80627 4386145 ~ 4394223 (-)
G287264 NA other upstream 1075202 5380720 ~ 5382001 (-)

Expression



Co-expression Network