G286985



Basic Information


Item Value
gene id G286985
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000072
NCBI id null
chromosome length 5473029
location 4753844 ~ 4754137 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU325345
CTTGTTTTAATCACATTTATTAATCATATGCATTGTGAATTGATTAGTCAAGTTCTCAAGAGACGTGGCCAAAAACTGTTGAGGATTTGGAGGTTTGTCCAGGATAAAGAATAAACATTATAATATTAAACATTAGCGTGTTAAAACAACTTGAGCCAAGGTGAACTACGAGGCGACACACTTCAGCAGCTTCATTCACAGTGGAAGGAGTACTCGGCCTCTGACTGATCACCTGAAGGAAAAGGAAGATGTTCACATT

Function


NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU325345 True 259 lncRNA 0.38 2 4753844 4754137

Neighbor


gene id symbol gene type direction distance location
CI01000072_04613981_04618187 USF1 coding downstream 135657 4613440 ~ 4618187 (-)
CI01000072_04602970_04610481 GKUP coding downstream 143363 4602849 ~ 4610481 (-)
CI01000072_04577347_04600719 UBASH3BB coding downstream 153125 4577049 ~ 4600719 (-)
CI01000072_04514012_04539785 NA coding downstream 213968 4512778 ~ 4539876 (-)
CI01000072_04315603_04316880 NA coding downstream 436964 4314911 ~ 4316880 (-)
CI01000072_04796909_04805902 NA coding upstream 42643 4796780 ~ 4805902 (-)
CI01000072_04810045_04816219 RILP coding upstream 55759 4809896 ~ 4816492 (-)
CI01000072_04818513_04830986 PRPF8, PRPF8.S coding upstream 64008 4818145 ~ 4831797 (-)
CI01000072_04932845_04949502 GIT1 coding upstream 178563 4932700 ~ 4949502 (-)
CI01000072_04992647_05006768 SSH2A coding upstream 238081 4992218 ~ 5006768 (-)
G286964 NA non-coding downstream 5232 4643960 ~ 4748612 (-)
G287101 NA non-coding downstream 11977 4737742 ~ 4741867 (-)
G286983 NA non-coding downstream 30475 4674193 ~ 4723369 (-)
G286977 NA non-coding downstream 53858 4694730 ~ 4699986 (-)
G287094 NA non-coding downstream 64041 4689227 ~ 4689803 (-)
G286974 NA non-coding upstream 6664 4760801 ~ 4761347 (-)
G287108 NA non-coding upstream 13045 4767182 ~ 4767850 (-)
G287109 NA non-coding upstream 14494 4768631 ~ 4768838 (-)
G287111 NA non-coding upstream 16940 4771077 ~ 4771436 (-)
G286997 NA non-coding upstream 41954 4796091 ~ 4796445 (-)
G287021 NA other downstream 359621 4386145 ~ 4394223 (-)
CI01000072_03972493_03983836 SPA17 other downstream 777777 3972401 ~ 3983836 (-)
G286005 NA other downstream 1754349 2993769 ~ 2999495 (-)
G285752 NA other downstream 2583186 2168048 ~ 2170658 (-)
G285766 NA other downstream 2745535 2005551 ~ 2008309 (-)
G287264 NA other upstream 626583 5380720 ~ 5382001 (-)

Expression



Co-expression Network