G287109



Basic Information


Item Value
gene id G287109
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000072
NCBI id null
chromosome length 5473029
location 4768631 ~ 4768838 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU325472
GTGATGTGAATGCATGTCGCTTTGTACTACACAGTATGTTGAGACAGAGGCGCCAGCCGCCAGGACTGCAACTAGCACGATACAACGTTATTTCTTCAAAAGCAGATCGTGGAGACTTTTAATTGTCCACGATCAAAATTGCACACCCCTATAAAGCCGCCTTTCCACTGCACACGACATTCGCATCCGATTGTCGCATTTCGCCCCC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU325472 True 208 lncRNA 0.49 1 4768631 4768838

Neighbor


gene id symbol gene type direction distance location
CI01000072_04613981_04618187 USF1 coding downstream 150444 4613440 ~ 4618187 (-)
CI01000072_04602970_04610481 GKUP coding downstream 158150 4602849 ~ 4610481 (-)
CI01000072_04577347_04600719 UBASH3BB coding downstream 167912 4577049 ~ 4600719 (-)
CI01000072_04514012_04539785 NA coding downstream 228755 4512778 ~ 4539876 (-)
CI01000072_04315603_04316880 NA coding downstream 451751 4314911 ~ 4316880 (-)
CI01000072_04796909_04805902 NA coding upstream 27942 4796780 ~ 4805902 (-)
CI01000072_04810045_04816219 RILP coding upstream 41058 4809896 ~ 4816492 (-)
CI01000072_04818513_04830986 PRPF8, PRPF8.S coding upstream 49307 4818145 ~ 4831797 (-)
CI01000072_04932845_04949502 GIT1 coding upstream 163862 4932700 ~ 4949502 (-)
CI01000072_04992647_05006768 SSH2A coding upstream 223380 4992218 ~ 5006768 (-)
G287108 NA non-coding downstream 781 4767182 ~ 4767850 (-)
G286974 NA non-coding downstream 7284 4760801 ~ 4761347 (-)
G286985 NA non-coding downstream 14494 4753844 ~ 4754137 (-)
G287101 NA non-coding downstream 26764 4737742 ~ 4741867 (-)
G286977 NA non-coding downstream 68645 4694730 ~ 4699986 (-)
G287111 NA non-coding upstream 2239 4771077 ~ 4771436 (-)
G286997 NA non-coding upstream 27253 4796091 ~ 4796445 (-)
G287129 NA non-coding upstream 72049 4840887 ~ 4841553 (-)
G286962 NA non-coding upstream 109302 4878140 ~ 4881638 (-)
G287154 NA non-coding upstream 254507 5023345 ~ 5023593 (-)
G287021 NA other downstream 374408 4386145 ~ 4394223 (-)
CI01000072_03972493_03983836 SPA17 other downstream 792564 3972401 ~ 3983836 (-)
G286005 NA other downstream 1769136 2993769 ~ 2999495 (-)
G285752 NA other downstream 2597973 2168048 ~ 2170658 (-)
G285766 NA other downstream 2760322 2005551 ~ 2008309 (-)
G287264 NA other upstream 611882 5380720 ~ 5382001 (-)

Expression



Co-expression Network