G302934


Basic Information

Item Value
gene id G302934
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000091
NCBI id null
chromosome length 1322612
location 166757 ~ 166971 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU344100
GAATTAACAGAGGTTTAGATGTTATTTTATTGGTCAAGAAAAAAAAGAAAAGAAAAAAACGAAAGAAAGTGTTGCAGCAAACTGTTATCTTGAATGATTTTAAAACCTTGTAGTGCATAAAAAAATTGAACTACTATATTATTAAGACACAAACAGACATCAAGAATCAGCATATAAATCTCAACAATGGTGATAATAAAATTTTTTTTAAAAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU344100 True 215 lncRNA 0.25 1 166757 166971

Neighbor

gene id symbol gene type direction distance location
CI01000091_00108499_00117102 CDKL1 coding downstream 47648 108220 ~ 119109 (-)
CI01000091_00265846_00269683 NA coding upstream 98869 265840 ~ 270360 (-)
CI01000091_00337653_00338300 CLDN3A coding upstream 170676 337647 ~ 338587 (-)
CI01000091_00346274_00346930 NA coding upstream 179046 346017 ~ 347510 (-)
CI01000091_00348777_00349430 NA coding upstream 181496 348467 ~ 349729 (-)
CI01000091_00400737_00412559 NA coding upstream 233469 400440 ~ 412559 (-)
G302931 NA non-coding downstream 2349 164203 ~ 164408 (-)
G302924 NA non-coding downstream 15206 151203 ~ 151551 (-)
G302902 NA non-coding downstream 36683 121975 ~ 130074 (-)
G302504 NA non-coding downstream 122851 42712 ~ 43906 (-)
G302937 NA non-coding upstream 2979 169950 ~ 170450 (-)
G302938 NA non-coding upstream 4263 171234 ~ 171527 (-)
G302939 NA non-coding upstream 5127 172098 ~ 172343 (-)
G302946 NA non-coding upstream 22615 189586 ~ 189895 (-)
G302970 NA non-coding upstream 74089 241060 ~ 241293 (-)
G303047 NA other upstream 307631 474602 ~ 562944 (-)

Expression


Co-expression Network