G302939



Basic Information


Item Value
gene id G302939
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000091
NCBI id null
chromosome length 1322612
location 172098 ~ 172343 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU344108
AAGCTTGATGAGCGCTTTCTCCCCGCACGGTCACTACCCCAGCGTCGGGGTCTGCCGTTCTTTCCCGACCTCCACACCGAGGTGTCGAGGTCGTGGAATAGACCAGTTCAGTATCGTGTGTTCAGCCCTCAAACATCAACATATAGTAACATCGTGGGGCTGAAACACCACGGCTATGGGGCGATGCCTCGGGTCGAAGAGACGCTTGCGAGCTATCTCTCGCCCGAGTCTGCATCGTCCCTCAAG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU344108 True 246 lncRNA 0.57 1 172098 172343

Neighbor


gene id symbol gene type direction distance location
CI01000091_00108499_00117102 CDKL1 coding downstream 52989 108220 ~ 119109 (-)
CI01000091_00265846_00269683 NA coding upstream 93497 265840 ~ 270360 (-)
CI01000091_00337653_00338300 CLDN3A coding upstream 165304 337647 ~ 338587 (-)
CI01000091_00346274_00346930 NA coding upstream 173674 346017 ~ 347510 (-)
CI01000091_00348777_00349430 NA coding upstream 176124 348467 ~ 349729 (-)
CI01000091_00400737_00412559 NA coding upstream 228097 400440 ~ 412559 (-)
G302938 NA non-coding downstream 571 171234 ~ 171527 (-)
G302937 NA non-coding downstream 1648 169950 ~ 170450 (-)
G302934 NA non-coding downstream 5127 166757 ~ 166971 (-)
G302931 NA non-coding downstream 7690 164203 ~ 164408 (-)
G302924 NA non-coding downstream 20547 151203 ~ 151551 (-)
G302946 NA non-coding upstream 17243 189586 ~ 189895 (-)
G302970 NA non-coding upstream 68717 241060 ~ 241293 (-)
G303002 NA non-coding upstream 156881 329224 ~ 329468 (-)
G303005 NA non-coding upstream 161345 333688 ~ 333932 (-)
G303017 NA non-coding upstream 195744 368087 ~ 369165 (-)
G303047 NA other upstream 302259 474602 ~ 562944 (-)

Expression



Co-expression Network