G304020


Basic Information

Item Value
gene id G304020
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 16924 ~ 17138 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU345428
GGCAAAATCCTCCTTTGGACTGTCCGCTGGAACACATGCCTTCGAACGCTCGCTCAGGCTGGCTTGGTAAAATACACAGAGCAATCAGTCTGGGTAGTGCGTCTGGCATGCAAGATGTAGAGAGTCCTGTGTATGAGCTTCCAACGGATGGTCACCCTGCTCCAGGCAGAGTGACTGAACTGCGGGGAGGTCCATTAAAGGAAAACACAAGAAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU345428 True 215 lncRNA 0.52 1 16924 17138

Neighbor

gene id symbol gene type direction distance location
CI01000092_00103480_00114306 NA coding upstream 85030 102168 ~ 114742 (-)
CI01000092_00116452_00128007 NA coding upstream 98197 115335 ~ 128007 (-)
CI01000092_00156990_00162891 MLNR coding upstream 139852 156990 ~ 162891 (-)
CI01000092_00174874_00180333 FNDC3A coding upstream 157736 174874 ~ 180333 (-)
CI01000092_00237358_00269420 NA coding upstream 219174 236312 ~ 271283 (-)
G304019 NA non-coding downstream 32 16666 ~ 16892 (-)
G304021 NA non-coding upstream 50 17188 ~ 17416 (-)
G304022 NA non-coding upstream 1284 18422 ~ 18624 (-)
G304025 NA non-coding upstream 5021 22159 ~ 22448 (-)
G304004 NA non-coding upstream 62375 79513 ~ 86265 (-)
G304012 NA non-coding upstream 74497 91635 ~ 93404 (-)
G304368 NA other upstream 1038166 1055304 ~ 1055722 (-)
G304369 NA other upstream 1041187 1058325 ~ 1058920 (-)
CI01000092_01086701_01097333 CLRN1 other upstream 1069524 1086404 ~ 1097333 (-)
G304459 NA other upstream 1214762 1231900 ~ 1232292 (-)
G305772 NA other upstream 2707456 2724594 ~ 2724944 (-)

Expression


Co-expression Network