G304218



Basic Information


Item Value
gene id G304218
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 777712 ~ 777947 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU345664
CTTTCTGATATTGCTCTACTATTTTTCGCCGCAGCATTGGGGGAATTGGTGATCCTCTGCCCATCTTGACTTCTGAGAGACACTGCCACTCTGAGAGGCTCTTTTTATACCCAATCATGTTGCCAATTGACCTAATAAGTTGCAAATTGGTCCTCCAGCTGTTCCTTATATGTACATTTAACTTTTCCGGCCTCTTATTGCTACCTGTCCCAACTTTTTTGGAATGTGTAGCTCTC

Function


NR:

description
PREDICTED: RE1-silencing transcription factor A-like

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU345664 True 236 lncRNA 0.43 1 777712 777947

Neighbor


gene id symbol gene type direction distance location
CI01000092_00579690_00648591 COG6 coding downstream 129121 579190 ~ 648591 (-)
CI01000092_00508717_00509840 NA coding downstream 267384 508594 ~ 510328 (-)
CI01000092_00506401_00508318 NA coding downstream 269188 505739 ~ 508524 (-)
CI01000092_00418628_00428488 SLC25A15, SLC25A15A coding downstream 349092 417822 ~ 428620 (-)
CI01000092_00409098_00411916 STOML3A, STOM, STOML3B, STOML3 coding downstream 365796 406264 ~ 411916 (-)
CI01000092_00847979_00851661 LPAR6A, LPAR6 coding upstream 69351 847298 ~ 851661 (-)
CI01000092_01054403_01069241 NA coding upstream 276399 1054346 ~ 1069241 (-)
CI01000092_01086701_01097333 CLRN1 coding upstream 308457 1086404 ~ 1097333 (-)
CI01000092_01099061_01100011 GPR171 coding upstream 320237 1098184 ~ 1100021 (-)
CI01000092_01110360_01113717 NA coding upstream 332332 1110279 ~ 1115228 (-)
G304091 NA non-coding downstream 213821 563555 ~ 563891 (-)
G304086 NA non-coding downstream 214315 557708 ~ 563397 (-)
G304085 NA non-coding downstream 244460 529353 ~ 533252 (-)
G304154 NA non-coding downstream 255340 522065 ~ 522372 (-)
G304152 NA non-coding downstream 257127 519836 ~ 520585 (-)
G304226 NA non-coding upstream 11859 789806 ~ 790021 (-)
G304260 NA non-coding upstream 108251 886198 ~ 886555 (-)
G304261 NA non-coding upstream 111757 889704 ~ 890059 (-)
G304264 NA non-coding upstream 115795 893742 ~ 894424 (-)
G304265 NA non-coding upstream 123253 901200 ~ 901632 (-)
G304368 NA other upstream 277357 1055304 ~ 1055722 (-)
G304369 NA other upstream 280378 1058325 ~ 1058920 (-)
G304459 NA other upstream 453953 1231900 ~ 1232292 (-)
G305772 NA other upstream 1946647 2724594 ~ 2724944 (-)

Expression



Co-expression Network