G304260



Basic Information


Item Value
gene id G304260
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 886198 ~ 886555 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU345717
TGGGAATAAATTACTTACCGCAGCTGGATCAATTGCATTCTTCTTCTTCTGAGGTAAATTCAAGGTTTATTCCTCACAATGCGTCTACCAAACTCAAAGAAAAGCAGAGGAATGATGAAGCTTGATGTTTGTTTATCAAGGTGATGGGGGCATTTACAGGTTTGCGTACCTCACACTTGGAATGCTGCGCAACGTGTGGGTGTGGTCACATTAAAGATAAATCAAGCGTAGCGTCAGTTCTGGCAGGTCACGTCAGTCAAGTTTGCATCAACTGACTCCCAGGTGACTCACGTCTACCTATAGGATACGACGCCTATCACAGCATCCATATATAATGCTGTGTTCCAGGCAGGTTTTT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU345717 True 358 lncRNA 0.44 1 886198 886555

Neighbor


gene id symbol gene type direction distance location
CI01000092_00847979_00851661 LPAR6A, LPAR6 coding downstream 34537 847298 ~ 851661 (-)
CI01000092_00579690_00648591 COG6 coding downstream 237607 579190 ~ 648591 (-)
CI01000092_00508717_00509840 NA coding downstream 375870 508594 ~ 510328 (-)
CI01000092_00506401_00508318 NA coding downstream 377674 505739 ~ 508524 (-)
CI01000092_00418628_00428488 SLC25A15, SLC25A15A coding downstream 457578 417822 ~ 428620 (-)
CI01000092_01054403_01069241 NA coding upstream 167791 1054346 ~ 1069241 (-)
CI01000092_01086701_01097333 CLRN1 coding upstream 199849 1086404 ~ 1097333 (-)
CI01000092_01099061_01100011 GPR171 coding upstream 211629 1098184 ~ 1100021 (-)
CI01000092_01110360_01113717 NA coding upstream 223724 1110279 ~ 1115228 (-)
CI01000092_01122961_01135673 NA coding upstream 236267 1122822 ~ 1136003 (-)
G304226 NA non-coding downstream 96177 789806 ~ 790021 (-)
G304218 NA non-coding downstream 108251 777712 ~ 777947 (-)
G304091 NA non-coding downstream 322307 563555 ~ 563891 (-)
G304086 NA non-coding downstream 322801 557708 ~ 563397 (-)
G304085 NA non-coding downstream 352946 529353 ~ 533252 (-)
G304261 NA non-coding upstream 3149 889704 ~ 890059 (-)
G304264 NA non-coding upstream 7187 893742 ~ 894424 (-)
G304265 NA non-coding upstream 14645 901200 ~ 901632 (-)
G304268 NA non-coding upstream 17831 904386 ~ 904688 (-)
G304269 NA non-coding upstream 23370 909925 ~ 910313 (-)
G304368 NA other upstream 168749 1055304 ~ 1055722 (-)
G304369 NA other upstream 171770 1058325 ~ 1058920 (-)
G304459 NA other upstream 345345 1231900 ~ 1232292 (-)
G305772 NA other upstream 1838039 2724594 ~ 2724944 (-)

Expression



Co-expression Network