G304436


Basic Information

Item Value
gene id G304436
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 1221866 ~ 1222070 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU345924
TGAACTGCCTGAGTTCACTCAAGGGCAGGACAGCGGCCCCACTGAAACTTTTTCACAGGCTCCTGGGGCATATGGCATCCGCAGCCACAGTCACGCCACTCGGATTGCTTCATATGAGGCCGCTTCAGCACTGGCTTCACAGCCGGGTCCCGAGATGGGCATGACAACGCGGTACGTTCTGTTTCCCTGTGACACCGAACTGCCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU345924 True 205 lncRNA 0.58 1 1221866 1222070

Neighbor

gene id symbol gene type direction distance location
CI01000092_01201434_01205306 NA coding downstream 15334 1199874 ~ 1206532 (-)
CI01000092_01186569_01191243 NA coding downstream 30333 1186121 ~ 1191533 (-)
CI01000092_01122961_01135673 NA coding downstream 85863 1122822 ~ 1136003 (-)
CI01000092_01110360_01113717 NA coding downstream 106638 1110279 ~ 1115228 (-)
CI01000092_01099061_01100011 GPR171 coding downstream 121845 1098184 ~ 1100021 (-)
CI01000092_01266540_01267541 NA coding upstream 44288 1266358 ~ 1268479 (-)
CI01000092_01270604_01273133 NA coding upstream 47675 1269745 ~ 1273133 (-)
CI01000092_01307631_01315805 NA coding upstream 85245 1307315 ~ 1315805 (-)
CI01000092_01317932_01336911 ANO7 coding upstream 95704 1317774 ~ 1338546 (-)
CI01000092_01352766_01386659 ECE2B, ECE2 coding upstream 130675 1352745 ~ 1386659 (-)
G304433 NA non-coding downstream 3722 1217854 ~ 1218144 (-)
G304432 NA non-coding downstream 4619 1216997 ~ 1217247 (-)
G304365 NA non-coding downstream 136472 1084513 ~ 1085394 (-)
G304380 NA non-coding downstream 145337 1076298 ~ 1076529 (-)
G304378 NA non-coding downstream 149869 1071410 ~ 1071997 (-)
G304423 NA non-coding upstream 3004 1225074 ~ 1225310 (-)
G304458 NA non-coding upstream 9044 1231114 ~ 1231434 (-)
G304468 NA non-coding upstream 49553 1271623 ~ 1271950 (-)
G304469 NA non-coding upstream 50073 1272143 ~ 1272360 (-)
G304477 NA non-coding upstream 64158 1286228 ~ 1286555 (-)
CI01000092_01086701_01097333 CLRN1 other downstream 124948 1086404 ~ 1097333 (-)
G304369 NA other downstream 162946 1058325 ~ 1058920 (-)
G304368 NA other downstream 166144 1055304 ~ 1055722 (-)
G304459 NA other upstream 9830 1231900 ~ 1232292 (-)
G305772 NA other upstream 1502524 2724594 ~ 2724944 (-)
G306014 NA other upstream 2455804 3677874 ~ 3679488 (-)
G306679 NA other upstream 3274344 4496414 ~ 4505953 (-)
G306792 NA other upstream 3582325 4804395 ~ 4865973 (-)

Expression


Co-expression Network