G304477


Basic Information

Item Value
gene id G304477
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 1286228 ~ 1286555 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU345968
CATATCGTTGGAAAGGTCTGAGTCTCACGGTTCATATTTGGTCATATTTGGTGTCTGTTTTGTGATAGAAGTGATATTTGGAAAGAAATGTATAAGTTTGTAACAGGAGAATGCATATAAAACAAATTCAATAGAATCTCTGTGACACCCGGTGGCTATTTTTGGTACAGCGCCTAAACAAAATTTCATAGGAACTTTAATTTTTGTGATATCAACTTCAAAGTGTTTAGCTATAAGCTTGCAGAATATGATACCAAGAGGCCAGAGCTGATTCTAGGAAAGATATTTTAGACATGATTAACATACACTATATTGCAAGAAGTACTGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU345968 True 328 lncRNA 0.34 1 1286228 1286555

Neighbor

gene id symbol gene type direction distance location
CI01000092_01270604_01273133 NA coding downstream 13095 1269745 ~ 1273133 (-)
CI01000092_01266540_01267541 NA coding downstream 17749 1266358 ~ 1268479 (-)
CI01000092_01201434_01205306 NA coding downstream 79696 1199874 ~ 1206532 (-)
CI01000092_01186569_01191243 NA coding downstream 94695 1186121 ~ 1191533 (-)
CI01000092_01122961_01135673 NA coding downstream 150225 1122822 ~ 1136003 (-)
CI01000092_01307631_01315805 NA coding upstream 20760 1307315 ~ 1315805 (-)
CI01000092_01317932_01336911 ANO7 coding upstream 31219 1317774 ~ 1338546 (-)
CI01000092_01352766_01386659 ECE2B, ECE2 coding upstream 66190 1352745 ~ 1386659 (-)
CI01000092_01451469_01485752 ATP1B3B coding upstream 164914 1451469 ~ 1485752 (-)
CI01000092_01488880_01522758 TFDP2 coding upstream 202325 1488880 ~ 1522758 (-)
G304469 NA non-coding downstream 13868 1272143 ~ 1272360 (-)
G304468 NA non-coding downstream 14278 1271623 ~ 1271950 (-)
G304458 NA non-coding downstream 54794 1231114 ~ 1231434 (-)
G304423 NA non-coding downstream 60918 1225074 ~ 1225310 (-)
G304436 NA non-coding downstream 64158 1221866 ~ 1222070 (-)
G304481 NA non-coding upstream 2884 1289439 ~ 1289777 (-)
G304484 NA non-coding upstream 58738 1345293 ~ 1345613 (-)
G304455 NA non-coding upstream 59774 1346329 ~ 1346888 (-)
G304487 NA non-coding upstream 137034 1423589 ~ 1423791 (-)
G304457 NA non-coding upstream 185453 1472008 ~ 1481912 (-)
G304459 NA other downstream 53936 1231900 ~ 1232292 (-)
CI01000092_01086701_01097333 CLRN1 other downstream 189310 1086404 ~ 1097333 (-)
G304369 NA other downstream 227308 1058325 ~ 1058920 (-)
G304368 NA other downstream 230506 1055304 ~ 1055722 (-)
G305772 NA other upstream 1438039 2724594 ~ 2724944 (-)
G306014 NA other upstream 2391319 3677874 ~ 3679488 (-)
G306679 NA other upstream 3209859 4496414 ~ 4505953 (-)
G306792 NA other upstream 3517840 4804395 ~ 4865973 (-)
G306902 NA other upstream 3867113 5153668 ~ 5154133 (-)

Expression


Co-expression Network