G304795


Basic Information

Item Value
gene id G304795
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 2049125 ~ 2049332 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU346315
GTCCTATTCTAGATCTGCGCCTATTAAATCGCTCTGTTAAGAAGCTCAAGTTCAGAATGAAACAAATCATGTCACAAATCAGGTCCGAGGACTGGTTTGTCACGATAGATCTGAAAGACGCATACTCTTATATATCCATACTTCCTCAACACAGGAAGTTCCTGAGGTTCGCTTCTGGGGGCGAAGCGTACCGATATCGGGTTCTTCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU346315 True 208 lncRNA 0.45 1 2049125 2049332

Neighbor

gene id symbol gene type direction distance location
CI01000092_02043716_02044633 OR128-10 coding downstream 4453 2043391 ~ 2044672 (-)
CI01000092_02039063_02039980 NA coding downstream 8792 2038840 ~ 2040333 (-)
CI01000092_02026073_02027161 NA coding downstream 21600 2026062 ~ 2027525 (-)
CI01000092_01981235_01981861 NA coding downstream 67264 1980463 ~ 1981861 (-)
CI01000092_01964262_01964863 NA coding downstream 84262 1964055 ~ 1964863 (-)
CI01000092_02055330_02056247 OR128-10 coding upstream 5685 2055017 ~ 2056286 (-)
CI01000092_02072036_02082309 OR128-10 coding upstream 22396 2071728 ~ 2083780 (-)
CI01000092_02134927_02166170 NA coding upstream 84486 2133818 ~ 2166547 (-)
CI01000092_02191463_02196322 NA coding upstream 141824 2191156 ~ 2196570 (-)
CI01000092_02408861_02410832 NA coding upstream 359249 2408581 ~ 2411486 (-)
G304777 NA non-coding downstream 43928 2004746 ~ 2005197 (-)
G304769 NA non-coding downstream 71906 1972782 ~ 1977219 (-)
G304768 NA non-coding downstream 83642 1965231 ~ 1965483 (-)
G304753 NA non-coding downstream 133658 1911977 ~ 1915467 (-)
G304853 NA non-coding upstream 76058 2125390 ~ 2161014 (-)
G304895 NA non-coding upstream 183187 2232519 ~ 2232949 (-)
G304898 NA non-coding upstream 189405 2238737 ~ 2239195 (-)
G304900 NA non-coding upstream 191073 2240405 ~ 2241173 (-)
G304902 NA non-coding upstream 195099 2244431 ~ 2244630 (-)
G304459 NA other downstream 816833 1231900 ~ 1232292 (-)
CI01000092_01086701_01097333 CLRN1 other downstream 952207 1086404 ~ 1097333 (-)
G304369 NA other downstream 990205 1058325 ~ 1058920 (-)
G304368 NA other downstream 993403 1055304 ~ 1055722 (-)
G305772 NA other upstream 675262 2724594 ~ 2724944 (-)
G306014 NA other upstream 1628542 3677874 ~ 3679488 (-)
G306679 NA other upstream 2447082 4496414 ~ 4505953 (-)
G306792 NA other upstream 2755063 4804395 ~ 4865973 (-)
G306902 NA other upstream 3104336 5153668 ~ 5154133 (-)

Expression


Co-expression Network