G305836


Basic Information

Item Value
gene id G305836
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 2800630 ~ 2802757 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU347511
AGTTATTATTGTGCAAAATATCTATGGATAATGTTTCTACAACAAATAAAAATAAAAAGGGGCTCAAAGGGCAACCGTGAATTTAAAATTATACAACTATCTATTTCTTTGTACAACATTTGAACAATATTTATGAATTTTGAGGGTAATCCAAAAGCCTCTAAAGAGTTTAGAAGGAACTGGTGCTTTACAGTATCGAAGGTCTTAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU347511 True 208 lncRNA 0.30 2 2800630 2802757

Neighbor

gene id symbol gene type direction distance location
CI01000092_02771083_02773297 NA coding downstream 23554 2771052 ~ 2777076 (-)
CI01000092_02750776_02767145 NA coding downstream 30577 2750740 ~ 2770053 (-)
CI01000092_02673622_02702051 URB1 coding downstream 98579 2673524 ~ 2702051 (-)
CI01000092_02616905_02658519 WDR62 coding downstream 141756 2616818 ~ 2658874 (-)
CI01000092_02602158_02608405 NA coding downstream 192225 2601686 ~ 2608405 (-)
CI01000092_02839795_02842383 NA coding upstream 37002 2839759 ~ 2842409 (-)
CI01000092_02851435_02865690 PHKG1B, PHKG1, PHKG1A coding upstream 47685 2850442 ~ 2865690 (-)
CI01000092_02868492_02873015 NA coding upstream 65716 2868473 ~ 2873015 (-)
CI01000092_02878710_02896014 HNRNPL2, HNRNPL coding upstream 75605 2878362 ~ 2896494 (-)
CI01000092_02902889_02909457 RET2, RBP2, RBP2A coding upstream 100055 2902812 ~ 2909489 (-)
G305835 NA non-coding downstream 3675 2796686 ~ 2796955 (-)
G305831 NA non-coding downstream 11778 2788482 ~ 2788852 (-)
G305781 NA non-coding downstream 52933 2747412 ~ 2747697 (-)
G305780 NA non-coding downstream 57816 2742566 ~ 2742814 (-)
G305776 NA non-coding downstream 66834 2733541 ~ 2733796 (-)
G305838 NA non-coding upstream 10043 2812800 ~ 2813059 (-)
G305842 NA non-coding upstream 18697 2821454 ~ 2821745 (-)
G305844 NA non-coding upstream 21848 2824605 ~ 2824873 (-)
CI01000092_02933754_02957495 BRWD1 non-coding upstream 151800 2933754 ~ 2957674 (-)
G305822 NA non-coding upstream 164818 2967575 ~ 2969733 (-)
G305772 NA other downstream 75686 2724594 ~ 2724944 (-)
G304459 NA other downstream 1568338 1231900 ~ 1232292 (-)
CI01000092_01086701_01097333 CLRN1 other downstream 1703712 1086404 ~ 1097333 (-)
G304369 NA other downstream 1741710 1058325 ~ 1058920 (-)
G304368 NA other downstream 1744908 1055304 ~ 1055722 (-)
G306014 NA other upstream 875117 3677874 ~ 3679488 (-)
G306679 NA other upstream 1693657 4496414 ~ 4505953 (-)
G306792 NA other upstream 2001638 4804395 ~ 4865973 (-)
G306902 NA other upstream 2350911 5153668 ~ 5154133 (-)

Expression


Co-expression Network