G306051


Basic Information

Item Value
gene id G306051
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 3586867 ~ 3587109 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU347737
GGTGCGTTGCATCTTCAGCTTTTCGCTTCGGAGCCGAACGGTGTTTGTTCCTGTTCTCTGCAAGCAAGTGTCTGCTAGAAGACGAGTCAAGCTTTTTGGTTGAACTTCTCTTTTTTTTTCGAGTGCGGGCGAACAGCACAGCAGCGGGGTCAAAGTCCTCTCTTTATTTTCTGTTTTTTGTTTCGTTTGCCATTATAGAGCAAATAGCTGTTTTGACAGCGTTAGAAGGCTGTTCTCACGGCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU347737 True 243 lncRNA 0.47 1 3586867 3587109

Neighbor

gene id symbol gene type direction distance location
CI01000092_03418301_03428309 ATM coding downstream 158558 3418301 ~ 3428309 (-)
CI01000092_03365550_03416277 ATM coding downstream 170590 3365007 ~ 3416277 (-)
CI01000092_03307794_03308422 NA coding downstream 278353 3307202 ~ 3308514 (-)
CI01000092_03271224_03274775 DSCAM coding downstream 311581 3271224 ~ 3275286 (-)
CI01000092_03224848_03225687 NA coding downstream 361072 3224461 ~ 3225795 (-)
CI01000092_03600064_03611514 MEIS3 coding upstream 12805 3599914 ~ 3612148 (-)
CI01000092_03614992_03615400 NA coding upstream 27328 3614437 ~ 3616983 (-)
CI01000092_03630767_03645397 PRSS16 coding upstream 43517 3630626 ~ 3646156 (-)
CI01000092_03652598_03660979 ECH1 coding upstream 65489 3652598 ~ 3661104 (-)
CI01000092_03682820_03688497 NA coding upstream 95305 3682263 ~ 3688531 (-)
G306050 NA non-coding downstream 9336 3577308 ~ 3577531 (-)
G306041 NA non-coding downstream 34288 3550840 ~ 3552579 (-)
G305991 NA non-coding downstream 42983 3537265 ~ 3543884 (-)
G306031 NA non-coding downstream 50269 3531872 ~ 3536598 (-)
G305809 NA non-coding downstream 58815 3470455 ~ 3528052 (-)
G306053 NA non-coding upstream 3624 3590733 ~ 3590979 (-)
G305810 NA non-coding upstream 10219 3597328 ~ 3598729 (-)
G306017 NA non-coding upstream 84336 3671445 ~ 3674434 (-)
G306010 NA non-coding upstream 89658 3676767 ~ 3677768 (-)
G305772 NA other downstream 861923 2724594 ~ 2724944 (-)
G304459 NA other downstream 2354575 1231900 ~ 1232292 (-)
CI01000092_01086701_01097333 CLRN1 other downstream 2489949 1086404 ~ 1097333 (-)
G304369 NA other downstream 2527947 1058325 ~ 1058920 (-)
G304368 NA other downstream 2531145 1055304 ~ 1055722 (-)
G306014 NA other upstream 90765 3677874 ~ 3679488 (-)
G306679 NA other upstream 909305 4496414 ~ 4505953 (-)
G306792 NA other upstream 1217286 4804395 ~ 4865973 (-)
G306902 NA other upstream 1566559 5153668 ~ 5154133 (-)

Expression


Co-expression Network