G306780


Basic Information

Item Value
gene id G306780
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 4764299 ~ 4766102 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU348577
TCCCCCTGCTGTACCGAACCCTCATGTTTGTGTTTGCATGACTGCAGTGAGCTGCTACTCACCTGCTTTCTTGATTCTCTTTCGCTCTTTGACCTGGTAGGGTTTGTGGTCATGTGACAGCGGGATGGCATTACCGTCTTTATCACACAGCACTGCCCTCGAATCGCCAACATTAGCTACAGTTAAGTCCTTCTCAGACAGCAGAGCCACCAGACACGTGGTACCTGCTTCATCATAGGAGGCCGACAGTTTCTCCAGGATCTCTTTGTCTATGTTGAGTATCTGCTGCTTGAGGATGGACTTATGAGTAAGAGCGCTGTTTTCTTTCTGCTTCTCATAGCGCTGGAGCTGCTGCCGCAACATGATGGGAAGATGAGACTTGGCATACTCTGCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU348577 True 394 lncRNA 0.50 2 4764299 4766102

Neighbor

gene id symbol gene type direction distance location
CI01000092_04730022_04742422 NMD3 coding downstream 21410 4729890 ~ 4742889 (-)
CI01000092_04692404_04694159 OTOL1B coding downstream 68823 4691840 ~ 4695476 (-)
CI01000092_04612376_04613032 NA coding downstream 151108 4612173 ~ 4613191 (-)
CI01000092_04545522_04550438 NA coding downstream 213560 4545236 ~ 4550739 (-)
CI01000092_04484800_04489910 NEU4 coding downstream 273151 4484233 ~ 4491148 (-)
CI01000092_04822399_04827194 NA coding upstream 55804 4821906 ~ 4827194 (-)
CI01000092_04838658_04840626 NA coding upstream 72106 4838208 ~ 4840626 (-)
CI01000092_04873079_04899153 SMC4 coding upstream 106749 4872851 ~ 4899153 (-)
CI01000092_04997617_05000398 NA coding upstream 231230 4997332 ~ 5000672 (-)
CI01000092_05003845_05017069 SCHIP1.S, SCHIP1 coding upstream 237702 5003804 ~ 5017408 (-)
G306752 NA non-coding downstream 19665 4743846 ~ 4744634 (-)
G306782 NA non-coding downstream 42477 4721585 ~ 4721822 (-)
G306777 NA non-coding downstream 52161 4711839 ~ 4712138 (-)
G306776 NA non-coding downstream 53715 4710365 ~ 4710584 (-)
G306764 NA non-coding downstream 74244 4689797 ~ 4690055 (-)
G306878 NA non-coding upstream 194456 4960558 ~ 4960838 (-)
G306905 NA non-coding upstream 392035 5158137 ~ 5158842 (-)
G306679 NA other downstream 258346 4496414 ~ 4505953 (-)
G306014 NA other downstream 1084811 3677874 ~ 3679488 (-)
G305772 NA other downstream 2039355 2724594 ~ 2724944 (-)
G304459 NA other downstream 3532007 1231900 ~ 1232292 (-)
CI01000092_01086701_01097333 CLRN1 other downstream 3667381 1086404 ~ 1097333 (-)
G306792 NA other upstream 38293 4804395 ~ 4865973 (-)
G306902 NA other upstream 387566 5153668 ~ 5154133 (-)

Expression


Co-expression Network