CI01000154_00776484_00783606 (CALML6, CALM2, CALM3, CALM1)


Basic Information

Item Value
gene id CI01000154_00776484_00783606
gene name CALML6, CALM2, CALM3, CALM1
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000154
NCBI id null
chromosome length 1600967
location 776484 ~ 783682 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000154_00776484_00783606.mRNA
GCAGATCAGCTGACCGAGGAACAGATTGCCGAGTTCAAGGAGGCGTTCTCACTCTTCGACAAAGATGGCGATGGCACCATTACCACCAAAGAGTTGGGCACAGTGATGCGCTCATTGGGTCAGAACCCCACTGAGGCTGAGCTCCAGGACATGATCAACGAGGTCGACGCTGATGGCAATGGAACTATAGACTTCCCAGAGTTCCTAACCATGATGGCGAGGAAAATGAAGGACACGGACAGTGAAGAGGAAATACGAGAAGCTTTCAGAGTCTTTGACAAGGATGGAAACGGCTACATCAGTGCAGCCGAGCTCCGTCACGTCATGACCAATCTGGGCGAGAAGTTGACAGATGAGGAAGTGGATGAGATGATCCGAGAGGCAGATATCGATGGAGACGGTCAAGTCAACTATGAAGAGTTTGTCCAGATGATGACTGCAAAGTGAAGGATTGTCTTATCCTGTATCTCTCTTTCTCTCTTACATTGCTTGTCCTACTAAGATCACTCTGTCTTTAAAAAGA

Function

symbol description
calm1 Enables several functions, including N-terminal myristoylation domain binding activity; enzyme activator activity; and enzyme binding activity. Involved in several processes, including positive regulation of hydrolase activity; regulation of calcium ion transmembrane transport; and regulation of heart contraction. Located in microtubule cytoskeleton and sarcomere. Part of calcium channel complex and catalytic complex. Implicated in catecholaminergic polymorphic ventricular tachycardia 4 and long QT syndrome 14. Biomarker of Alzheimer's disease.
calm2 Enables several functions, including N-terminal myristoylation domain binding activity; enzyme activator activity; and enzyme binding activity. Involved in several processes, including positive regulation of hydrolase activity; regulation of calcium ion transmembrane transport; and regulation of heart contraction. Located in microtubule cytoskeleton and sarcomere. Part of calcium channel complex and catalytic complex. Implicated in long QT syndrome 15. Biomarker of major depressive disorder.
calm3 Enables several functions, including N-terminal myristoylation domain binding activity; enzyme activator activity; and enzyme binding activity. Involved in several processes, including positive regulation of hydrolase activity; regulation of calcium ion transmembrane transport; and regulation of heart contraction. Located in microtubule cytoskeleton and sarcomere. Part of calcium channel complex and catalytic complex. Implicated in familial hypertrophic cardiomyopathy.
calml6 Predicted to enable calcium ion binding activity and enzyme regulator activity. Predicted to be involved in regulation of catalytic activity. Predicted to be located in cytoplasm and nucleus.

GO:      GO:0005088, GO:0048306, GO:0000086, GO:0007190, GO:0006936, GO:0030426, GO:0010801, GO:0010800, GO:0035307, GO:0030017, GO:0034704, GO:0021762, GO:0051412, GO:0022400, GO:0043388, GO:0071902, GO:0044325, GO:0007223, GO:0005876, GO:0005737, GO:0031432, GO:0031982, GO:0008440, GO:0002576, GO:0005980, GO:0005813, GO:0005634, GO:0032516, GO:0000165, GO:0015276, GO:0000922, GO:0005654, GO:0002027, GO:0005509, GO:0032465, GO:1901841, GO:0007186, GO:1901844, GO:0051343, GO:0005515, GO:0031800, GO:0050998, GO:0030235, GO:0008076, GO:0051592, GO:0060315, GO:0060316, GO:0043274, GO:0019904, GO:0005886, GO:0008179, GO:0055117, GO:0043539, GO:0070062, GO:0050999, GO:0019901, GO:0038095, GO:0031996, GO:0034220, GO:0005829, GO:0031997, GO:0030801, GO:0001975, GO:0043647, GO:0043547, GO:0005513, GO:0072542, GO:0005576, GO:0010881, GO:0010880, GO:0051000, GO:0031954, GO:0043548

KEGG:

id description
K02183 CALM; calmodulin

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000154_00776484_00783606.mRNA True 523 mRNA 0.48 5 776484 783682

Neighbor

gene id symbol gene type direction distance location
CI01000154_00753231_00755134 TRAPPC4.S, TRAPPC4 coding upstream 21350 751150 ~ 755134 (+)
CI01000154_00709450_00737541 SACS coding upstream 38240 708287 ~ 738244 (+)
CI01000154_00641532_00674274 GAB2 coding upstream 102210 641532 ~ 674274 (+)
CI01000154_00583484_00594396 NARS2 coding upstream 182053 583484 ~ 594431 (+)
CI01000154_00418700_00562133 TENM4 coding upstream 214351 418700 ~ 562133 (+)
CI01000154_00887422_00890641 NA coding downstream 103740 887422 ~ 890943 (+)
CI01000154_00902311_00907798 RHOUB coding downstream 118372 902054 ~ 907995 (+)
CI01000154_00956115_00973357 RAB4B, MIA-RAB4B, RAB4A coding downstream 171348 955030 ~ 973682 (+)
CI01000154_01001933_01010068 NA coding downstream 218212 1001894 ~ 1010582 (+)
CI01000154_01057020_01083988 ARHGAP35 coding downstream 273102 1056784 ~ 1086056 (+)
G361584 NA non-coding upstream 68868 706992 ~ 707616 (+)
G361580 NA non-coding upstream 89226 687049 ~ 687258 (+)
G361578 NA non-coding upstream 92149 684094 ~ 684335 (+)
G361569 NA non-coding upstream 193876 581978 ~ 582608 (+)
CI01000154_00378861_00412679 NA non-coding upstream 363193 378861 ~ 413291 (+)
G361605 NA non-coding downstream 10447 794129 ~ 797777 (+)
G361627 NA non-coding downstream 50421 834103 ~ 834363 (+)
G361628 NA non-coding downstream 52663 836345 ~ 836602 (+)
G361631 NA non-coding downstream 63036 846718 ~ 847242 (+)
G361694 NA non-coding downstream 78997 862679 ~ 862917 (+)
CI01000154_01258168_01258920 RAB34 other downstream 473689 1257371 ~ 1258920 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location