G361726


Basic Information

Item Value
gene id G361726
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000154
NCBI id null
chromosome length 1600967
location 993387 ~ 993598 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU412522
GTGGGAGCAGAGACCTTTCACAGTTTCTTTACTTCACCAAAAGCAGTTTGTTGTGAAAGGCTGCGGTTTTACTAATGAACTATGTGTCATGATAAATACCATTATGAATAACTGCAAATAACTGGATTTAACTTCTGTTTCTGTCATTTTAGTTTTGTAGGCCTATTTATAGAAATACAACAGAGAGCTCTTTTTATTTAACTTTTACCCCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU412522 True 212 lncRNA 0.34 1 993387 993598

Neighbor

gene id symbol gene type direction distance location
CI01000154_00956115_00973357 RAB4B, MIA-RAB4B, RAB4A coding upstream 19705 955030 ~ 973682 (+)
CI01000154_00902311_00907798 RHOUB coding upstream 85392 902054 ~ 907995 (+)
CI01000154_00887422_00890641 NA coding upstream 102444 887422 ~ 890943 (+)
CI01000154_00776484_00783606 CALML6, CALM2, CALM3, CALM1 coding upstream 209705 776484 ~ 783682 (+)
CI01000154_00753231_00755134 TRAPPC4.S, TRAPPC4 coding upstream 238253 751150 ~ 755134 (+)
CI01000154_01001933_01010068 NA coding downstream 8296 1001894 ~ 1010582 (+)
CI01000154_01057020_01083988 ARHGAP35 coding downstream 63186 1056784 ~ 1086056 (+)
CI01000154_01134763_01169402 NPAS1 coding downstream 141165 1134763 ~ 1169416 (+)
CI01000154_01186882_01191062 NA coding downstream 193284 1186882 ~ 1191062 (+)
CI01000154_01191290_01198704 NA coding downstream 197692 1191290 ~ 1198707 (+)
G361637 NA non-coding upstream 2155 981793 ~ 991232 (+)
G361670 NA non-coding upstream 23313 967354 ~ 970074 (+)
G361694 NA non-coding upstream 130470 862679 ~ 862917 (+)
G361631 NA non-coding upstream 146145 846718 ~ 847242 (+)
G361628 NA non-coding upstream 156785 836345 ~ 836602 (+)
G361728 NA non-coding downstream 1374 994972 ~ 995197 (+)
G361729 NA non-coding downstream 2256 995854 ~ 996076 (+)
G361735 NA non-coding downstream 106443 1100041 ~ 1100269 (+)
G361738 NA non-coding downstream 107920 1101518 ~ 1101840 (+)
G361653 NA non-coding downstream 253658 1247256 ~ 1248166 (+)
CI01000154_01258168_01258920 RAB34 other downstream 263773 1257371 ~ 1258920 (+)

Expression


Co-expression Network