G381033



Basic Information


Item Value
gene id G381033
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000189
NCBI id null
chromosome length 4726117
location 2604912 ~ 2605202 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU435594
ATTGAATCTCTGGTTTACACTATTTTAAGGTGTCTTTGTTACACTGTAATTATATATTTAAGTACTGAGTATTATTAAGTAACTACATGTATTTACTATAGATTTAGGATTAGGGTTTGGTTTGGTTTGGTTTAGGGTTAGTTGCATGTAATTATGCATAATTTATAGTTATTACTATAGTAACTACATGTAACATATGTAACAATGACACTGTAAAATAAAGTGTTACCCAGGTCTGTTTTTGCGCAAAAGTCAATTAAATTTTTACAAACAAATAGAATCACTCTGACT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU435594 True 291 lncRNA 0.28 1 2604912 2605202

Neighbor


gene id symbol gene type direction distance location
CI01000189_02469062_02471153 NA coding downstream 133759 2468614 ~ 2471153 (-)
CI01000189_02450025_02461432 NA coding downstream 143413 2449828 ~ 2461499 (-)
CI01000189_02404459_02433659 ESRRG, ESRRGA coding downstream 171253 2404459 ~ 2433659 (-)
CI01000189_02383475_02386489 NA coding downstream 217789 2382566 ~ 2387123 (-)
CI01000189_02167284_02313164 USH2A coding downstream 291748 2167284 ~ 2313164 (-)
CI01000189_02663877_02665709 NA coding upstream 57887 2663089 ~ 2665790 (-)
CI01000189_02686987_02689446 NA coding upstream 80839 2686041 ~ 2689635 (-)
CI01000189_02823407_02846026 ITSN2, ITSN2B coding upstream 218205 2823407 ~ 2846026 (-)
CI01000189_02924018_02946613 SH3YL1 coding upstream 318099 2923301 ~ 2946613 (-)
CI01000189_02961166_02963382 NA coding upstream 355368 2960570 ~ 2963454 (-)
G380882 NA non-coding downstream 410398 2194257 ~ 2194514 (-)
G380863 NA non-coding downstream 452827 2149956 ~ 2152085 (-)
G380803 NA non-coding downstream 496625 2107024 ~ 2108287 (-)
G380572 NA non-coding downstream 794683 1809958 ~ 1810229 (-)
G380535 NA non-coding downstream 862095 1733475 ~ 1742817 (-)
G381035 NA non-coding upstream 7426 2612628 ~ 2612875 (-)
G381047 NA non-coding upstream 45775 2650977 ~ 2651299 (-)
G381184 NA non-coding upstream 111094 2716296 ~ 2716501 (-)
G381185 NA non-coding upstream 112158 2717360 ~ 2717845 (-)
G381202 NA non-coding upstream 131482 2736684 ~ 2736957 (-)
G380177 NA other downstream 1706472 894220 ~ 898517 (-)
CI01000189_00764790_00765233 ID3 other downstream 1839535 764674 ~ 765776 (-)
G381317 NA other upstream 393671 2998873 ~ 3006444 (-)
G382060 NA other upstream 1225425 3830627 ~ 3832613 (-)
G382052 NA other upstream 1280360 3885562 ~ 3892909 (-)
G382153 NA other upstream 1540388 4145590 ~ 4146084 (-)

Expression



Co-expression Network