G382003


Basic Information

Item Value
gene id G382003
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000189
NCBI id null
chromosome length 4726117
location 3638729 ~ 3687279 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU436711
GCCCTTTCCTACGTCTTAAAGTGATGATCATCTCCACGACCAGAGGAAGGTAAAGGACAGTCAGTAACCAGTACATATTGTCATTCTTCACTGTTTTCACTCTCCAGACGCCGATGAGAGAGACCAGAATGAATAAGGACCTGGTTATGATCGCGCACACGAATTTAACTAAAATCATCTTAAAGACAATAGTGTCCCGGGTTTGTGCGATAAAGTGCGCTTTAGAGAGTCCACTTGAGTCTCCAGTTTGTGTTGAACCCTCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU436711 True 263 lncRNA 0.44 2 3638729 3687279

Neighbor

gene id symbol gene type direction distance location
CI01000189_03608917_03613975 FAM175B coding downstream 24754 3608235 ~ 3613975 (-)
CI01000189_03557950_03558676 DTD2 coding downstream 80053 3557808 ~ 3558676 (-)
CI01000189_03546199_03556875 NA coding downstream 81854 3546199 ~ 3556875 (-)
CI01000189_03517928_03524647 VSX2 coding downstream 114017 3517283 ~ 3524712 (-)
CI01000189_03506782_03513494 ZNF839 coding downstream 125235 3506782 ~ 3513494 (-)
CI01000189_03699588_03706531 CDK1 coding upstream 11969 3699248 ~ 3706834 (-)
CI01000189_03903426_03904603 NPY4R coding upstream 215655 3902934 ~ 3904603 (-)
CI01000189_03950993_03958722 NA coding upstream 262894 3950173 ~ 3958722 (-)
CI01000189_03980640_03981210 NA coding upstream 293334 3980613 ~ 3981210 (-)
CI01000189_03983572_04013988 LARP1B coding upstream 295087 3982366 ~ 4014133 (-)
G381998 NA non-coding downstream 17640 3620874 ~ 3621089 (-)
G381867 NA non-coding downstream 134764 3502618 ~ 3503965 (-)
G381961 NA non-coding downstream 148099 3490418 ~ 3490630 (-)
G381951 NA non-coding downstream 164292 3474224 ~ 3474437 (-)
G381855 NA non-coding downstream 272597 3365314 ~ 3366132 (-)
G381978 NA non-coding upstream 9607 3696886 ~ 3697697 (-)
G382036 NA non-coding upstream 24948 3712227 ~ 3712452 (-)
G382093 NA non-coding upstream 64443 3751722 ~ 3752001 (-)
G382094 NA non-coding upstream 68439 3755718 ~ 3755924 (-)
G382051 NA non-coding upstream 212212 3899491 ~ 4044999 (-)
G381317 NA other downstream 632285 2998873 ~ 3006444 (-)
CI01000189_02961166_02963382 NA other downstream 675275 2960570 ~ 2963454 (-)
G380177 NA other downstream 2740289 894220 ~ 898517 (-)
CI01000189_00764790_00765233 ID3 other downstream 2873352 764674 ~ 765776 (-)
G382060 NA other upstream 143348 3830627 ~ 3832613 (-)
G382052 NA other upstream 198283 3885562 ~ 3892909 (-)
G382153 NA other upstream 458311 4145590 ~ 4146084 (-)

Expression


Co-expression Network