G390729


Basic Information

Item Value
gene id G390729
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000208
NCBI id null
chromosome length 699623
location 548726 ~ 549309 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU447328
AAAATACTACAATTGAAAAATGTTTATATTAAATATAAAATTCAACCTGCCAAGGTGGCTAGTAGGAGTGACTGTGTTACAATCCGCTGCTGAAATCCACCCGCATTTGGCAGGTTAGCGGGTGTTAAAGGGTTAAATTTTGTCATTAATTACTCACCCTCATGTCATTCCACACCCGTAAGACCTTTGTTCATCTTCAGAACACAAATTAAGATATTTTTGATAAAATCCGATGGCTCAGTGAGGCCTGCATTGCCAGCAAGATCATTTCCTTTTTCAATGCCCAGAAAGCTACTAAAGACATGTTTAAAACAGTTCATGTGACTACAGTGGTTCGACCTTAATGTTATGAAGTGACGAGAATACTTTTTGTGAGCCAAAAAAACACAAAATAACAACTTTAATCAACAATATCTAGTGATGGGTGATTTCAGAACACTGCATCATGAAGCTTTACGAATCTTTTGTTTTGAATCAGTGGTTCGGAGTGCCAAAATCACGTGATTTCAGTAAACGAGGCTTTGTTACGCCATAAGTGTTTTGAAACTTCAGTAGTTCACGTGACTTTGCCAGTTTGATACGCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU447328 True 584 lncRNA 0.38 1 548726 549309

Neighbor

gene id symbol gene type direction distance location
CI01000208_00533761_00535474 NA coding upstream 13252 533611 ~ 535474 (+)
CI01000208_00508002_00511190 NA coding upstream 37469 507148 ~ 511257 (+)
CI01000208_00479959_00498664 NA coding upstream 49255 479145 ~ 499471 (+)
CI01000208_00388124_00395613 DNAJA3, DNAJA3A coding upstream 152805 387628 ~ 395921 (+)
CI01000208_00314910_00326888 NA coding upstream 221821 313308 ~ 326962 (+)
CI01000208_00554756_00555762 NA coding downstream 5260 554569 ~ 558695 (+)
CI01000208_00571370_00591616 CCNF coding downstream 22061 571370 ~ 592484 (+)
CI01000208_00611303_00616477 NA coding downstream 61994 611303 ~ 616800 (+)
CI01000208_00622771_00646633 ABCA3B, ABCA3 coding downstream 73462 622771 ~ 647166 (+)
CI01000208_00655853_00657320 NA coding downstream 104704 654013 ~ 657529 (+)
G390631 NA non-coding upstream 45585 475836 ~ 503141 (+)
G390621 NA non-coding upstream 89308 458666 ~ 459418 (+)
G390634 NA non-coding upstream 90745 456197 ~ 457981 (+)
G390632 NA non-coding upstream 95571 439332 ~ 453155 (+)
G390737 NA non-coding downstream 3351 552660 ~ 552867 (+)
G390749 NA non-coding downstream 122580 671889 ~ 672382 (+)
G390620 NA other downstream 110289 679966 ~ 680035 (+)

Expression


Co-expression Network