G409388



Basic Information


Item Value
gene id G409388
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000300
NCBI id null
chromosome length 11740502
location 1632490 ~ 1632828 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU470376
GCGATGGTTTTTTGTCAAATAAATATCCATATTTAAAACTTTATTAACTATAATAATCAGCTTCCAACAGATGGCCGTACGCATTGATTTGCGGCAGAAGAGTGAACTCTGACCTGACTCATGACGTAATGGTGAACGCGTAAGCACAGAGGATAGAGCAAAATAAAACACCGGTCACGAATTAGAAGTCTAAAATGAGAAATTTTAAAGAGAAATGTTGGAGGATTTCGATGTAAGATAAGAGAAGCTTCAGCCAAATTTGTTTAAACCATGAGAGTTTTAAATATGGATATTTTTCTTACAAAAACCCCTCGCTTCACTTCAGAAGGCTTTCATTAA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU470376 True 339 lncRNA 0.35 1 1632490 1632828

Neighbor


gene id symbol gene type direction distance location
CI01000300_01623190_01629652 CNPY3, TNRC5 coding downstream 1451 1622883 ~ 1631039 (-)
CI01000300_01537230_01547051 NA coding downstream 85439 1537176 ~ 1547051 (-)
CI01000300_01387744_01388660 NA coding downstream 243252 1387744 ~ 1389238 (-)
CI01000300_01384469_01386368 FGA coding downstream 246122 1384319 ~ 1386368 (-)
CI01000300_01381458_01383409 NA coding downstream 249081 1381005 ~ 1383409 (-)
CI01000300_01634104_01696058 TRPC5A coding upstream 1276 1634104 ~ 1696058 (-)
CI01000300_01726202_01727298 NA coding upstream 93206 1726034 ~ 1727298 (-)
CI01000300_01730095_01731153 NA coding upstream 97267 1730095 ~ 1731153 (-)
CI01000300_01733901_01736015 NA coding upstream 100832 1733660 ~ 1736022 (-)
CI01000300_01742156_01744802 NA coding upstream 109328 1742156 ~ 1744802 (-)
G409424 NA non-coding downstream 13406 1618850 ~ 1619084 (-)
G409402 NA non-coding downstream 17837 1563145 ~ 1614653 (-)
G409411 NA non-coding downstream 39180 1592979 ~ 1593310 (-)
G409399 NA non-coding downstream 80765 1551354 ~ 1551725 (-)
G409374 NA non-coding downstream 92674 1539580 ~ 1539816 (-)
G409454 NA non-coding upstream 130557 1763385 ~ 1763621 (-)
G409380 NA non-coding upstream 139263 1772091 ~ 1784816 (-)
G409459 NA non-coding upstream 145673 1778501 ~ 1780832 (-)
G409513 NA non-coding upstream 347902 1980730 ~ 1981204 (-)
G409515 NA non-coding upstream 349216 1982044 ~ 1982308 (-)
G408318 NA other downstream 1345603 279917 ~ 286887 (-)
G409558 NA other upstream 654353 2287181 ~ 2288973 (-)
G409775 NA other upstream 1230330 2863158 ~ 2863998 (-)
G410498 NA other upstream 2168311 3801139 ~ 3808207 (-)
CI01000300_04075307_04079312 NA other upstream 2443936 4074636 ~ 4080539 (-)
G411012 NA other upstream 2757492 4390320 ~ 4395121 (-)

Expression



Co-expression Network