CI01000306_08690665_08696165 (ARL8BA, ARL8B, ARL8BB, ARL8A)


Basic Information

Item Value
gene id CI01000306_08690665_08696165
gene name ARL8BA, ARL8B, ARL8BB, ARL8A
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 8690665 ~ 8696165 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000306_08690665_08696165.mRNA
CAGGAACAGAATCTGCCCTGCCTCATCCTTACCATCAGAGTTCATCCAGCAGCGCAGAGATGTTGGCCCTCTTCCACCGGCTCCTGGACTGGCTCAGGTCGCTCTTCTGGAAGGAGGAGATGGAGCTGACGCTGGTGGGACTGCAGTACTCTGGAAAAACCACTTTTGTCAACGTGATTGCTTCTGGTCAGTTCAATGAAGACATGATTCCTACAGTCGGCTTCAACATGAGGAAAGTCACCAAAGGCAACGTAACCATAAAAATTTGGGATATAGGCGGGCAGCCGCGGTTCAGGAGCATGTGGGAGCGATACTGTCGGGGCGTCAACGCTATAGTGTACATGGTGGATGCTGCAGATCGTGATAAGGTGGAAGCCTCAAGAAACGAGCTACACAACTTGTTAGACAAACCACAGCTGCAAGGCATTCCTGTACTTGTCCTTGGCAACAAAAGAGACATCCCTATTGCGCTAGACGAGAAACAACTCATTGAAAAGATGAACCTGTCTGCCATTCAAGACCGAGAGATCTGCTGCTACTCCATTTCATGCAAAGAGAAAGACAATATAG

Function

symbol description
arl8bb Predicted to enable GTP binding activity and GTPase activity. Predicted to act upstream of or within protein transport. Predicted to be located in late endosome membrane and lysosome. Predicted to be active in lysosomal membrane. Orthologous to human ARL8B (ADP ribosylation factor like GTPase 8B).
arl8ba Predicted to enable GTP binding activity and GTPase activity. Predicted to be involved in autophagosome-lysosome fusion; late endosome to lysosome transport; and lysosome localization. Predicted to act upstream of or within cell division; chromosome segregation; and protein transport. Predicted to be located in lysosome. Predicted to be active in lysosomal membrane. Orthologous to human ARL8B (ADP ribosylation factor like GTPase 8B).
arl8a Predicted to enable GTP binding activity and GTPase activity. Predicted to act upstream of or within protein transport. Predicted to be located in late endosome membrane and lysosome. Predicted to be active in lysosomal membrane. Orthologous to human ARL8A (ADP ribosylation factor like GTPase 8A).
arl8b Enables guanyl ribonucleotide binding activity and tubulin binding activity. Involved in several processes, including calcium ion regulated lysosome exocytosis; lysosomal transport; and vesicle fusion. Located in cytolytic granule membrane; midbody; and spindle midzone. Colocalizes with lysosomal membrane.

GO:

id name namespace
GO:0032418 lysosome localization biological_process

KEGG:

id description
K07955 ARL8; ADP-ribosylation factor-like protein 8

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000306_08690665_08696165.mRNA True 570 mRNA 0.49 6 8690665 8696165

Neighbor

gene id symbol gene type direction distance location
CI01000306_08596204_08597372 NA coding downstream 92261 8595875 ~ 8598404 (-)
CI01000306_08533490_08558727 SEMA3FB, SEMA3F coding downstream 131511 8533428 ~ 8559154 (-)
CI01000306_08521837_08523740 NA coding downstream 166895 8521033 ~ 8523770 (-)
CI01000306_08349295_08353547 TRAIP coding downstream 337118 8349156 ~ 8353547 (-)
CI01000306_08208426_08210350 NA coding downstream 480295 8208224 ~ 8210370 (-)
CI01000306_08699884_08701812 BHLHE40 coding upstream 2404 8698569 ~ 8703451 (-)
CI01000306_08710919_08824478 ITPR1 coding upstream 13439 8709604 ~ 8824478 (-)
CI01000306_08862287_08863560 SETMAR coding upstream 165954 8862119 ~ 8863560 (-)
CI01000306_08864809_08865809 BRK1, BRK1.S, BRK1.L coding upstream 168629 8864794 ~ 8866213 (-)
CI01000306_08868661_08869685 GPX1A, GPX1 coding upstream 172017 8868182 ~ 8870046 (-)
G436211 NA non-coding downstream 222065 8468362 ~ 8468600 (-)
G436198 NA non-coding downstream 247458 8442991 ~ 8443207 (-)
G436193 NA non-coding downstream 260291 8429759 ~ 8430374 (-)
G436180 NA non-coding downstream 278731 8404724 ~ 8411934 (-)
G436182 NA non-coding downstream 288717 8399564 ~ 8401948 (-)
G436337 NA non-coding upstream 130439 8826604 ~ 8827451 (-)
G436383 NA non-coding upstream 225449 8921614 ~ 8921940 (-)
G436386 NA non-coding upstream 227405 8923570 ~ 8923780 (-)
G434338 NA other downstream 1823729 6866656 ~ 6866936 (-)
G434086 NA other downstream 2238414 6437406 ~ 6452251 (-)
G434016 NA other downstream 2329022 6355180 ~ 6361643 (-)
G433985 NA other downstream 2493455 6196107 ~ 6197210 (-)
G433670 NA other downstream 2649382 6041014 ~ 6041283 (-)
G436446 NA other upstream 960114 9656279 ~ 9671776 (-)
G436626 NA other upstream 1138860 9835025 ~ 9836323 (-)
G436643 NA other upstream 1325983 10022148 ~ 10025375 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_004258 arl8bb coding NC_007122.7 CM002895.2 35744918 ~ 35756468 (-)
bowfin (Amia calva) AMCG00014007 arl8a,LOC107671521,LOC107569762,LOC105900530,LOC107750681,LOC107722853 coding CM030125.1 CM030125.1 49456627 ~ 49463170 (-)