XLOC_012947 (tmem91)


Basic Information

Item Value
gene id XLOC_012947
gene name tmem91
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007129.7
NCBI id CM002902.2
chromosome length 51023478
location 36037223 ~ 36046166 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00025789
GACTCCTCCAGTGATGACTTCAGTGATACAGACAGTGAGAGCAACTTTCCCATCATGATCCCTCAAGATTACCTGGGTCTGGCTTTCTTCTCCATGCTCTGTTGTTTCTGGCCTCTGGGCATTGCTGCGTTCTATCTTTCCCAAAAGACAAACAAAGCGTCAGCACAAGGAGATTTCCAGGGTGCCAGTGCAGCTTCTCGGCAGGCTCTGTGGCTCTCCATCCTTTCAATCGTGTTCGGCATCATCACTTACATCTGTGCCATCGCTGCCCTGATCTCCTATTTGTCTGGAAAACCACCTTAA

Function

symbol description
tmem91 Predicted to be integral component of membrane. Predicted to be active in intracellular membrane-bounded organelle and membrane. Orthologous to human TMEM91 (transmembrane protein 91).

GO:

id name namespace
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component

KEGG:

id description
ko02000 Transporters

ZFIN:

id description
ZDB-GENE-060503-581 Predicted to be integral component of membrane. Predicted to be active in intracellular membrane-bounded organelle and membrane. Orthologous to human TMEM91 (transmembrane protein 91).

Ensembl:

ensembl_id ENSDARG00000068456

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00025789 True 303 mRNA 0.50 2 36037223 36046166

Neighbor

gene id symbol gene type direction distance location
XLOC_012946 ppp1r13l coding upstream 137606 35842933 ~ 35899617 (+)
XLOC_012945 CR377223.2 coding upstream 217660 35819449 ~ 35819563 (+)
XLOC_012944 CR377223.1 coding upstream 230257 35806848 ~ 35806966 (+)
XLOC_012943 rasgrp4 coding upstream 234740 35742838 ~ 35802483 (+)
XLOC_012942 NA coding upstream 605375 35431006 ~ 35431848 (+)
XLOC_012948 bckdha coding downstream 20223 36066389 ~ 36081908 (+)
XLOC_012949 NA coding downstream 95050 36141216 ~ 36409313 (+)
XLOC_012950 siae coding downstream 536649 36582815 ~ 36598693 (+)
XLOC_012951 clasrp coding downstream 555237 36601403 ~ 36648298 (+)
XLOC_012952 capn12 coding downstream 618488 36664654 ~ 36729637 (+)
XLOC_012937 NA non-coding upstream 961449 35075415 ~ 35075774 (+)
XLOC_012936 AL935279.1 non-coding upstream 962586 35072976 ~ 35074637 (+)
XLOC_012956 NA non-coding downstream 838451 36884617 ~ 36884817 (+)
XLOC_012958 NA non-coding downstream 897025 36943191 ~ 36944417 (+)
XLOC_012960 NA non-coding downstream 1002339 37048505 ~ 37053102 (+)
XLOC_012963 NA non-coding downstream 1226349 37272515 ~ 37281166 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000180_01041380_01050209 TMEM91 coding CI01000180 null 1041295 ~ 1050447 (+)