G456800


Basic Information

Item Value
gene id G456800
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000321
NCBI id null
chromosome length 5206101
location 495235 ~ 495481 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU524362
CAATGTCATCAATAACATTATTCACTTTTGAGTTAAAAGAATCAAGGAGAAAATCAACAGAGTCTGCAGATATGTTTGGTGTTAAAGATATAGCCTTCATAAACAGCACACTAGTTTTCTCATTTAAGCATCGCTTTTTGACCGAAATAGATCTTCAACAGTAGGAGAGATCAATATATCAAAGAAAATACAGAAATGATCAGATAGCACTACATCCTTAATAACAATGGATGATATGTTTAGACCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU524362 True 247 lncRNA 0.32 1 495235 495481

Neighbor

gene id symbol gene type direction distance location
CI01000321_00441382_00448773 RPS18.L, GM10260, RPS18, RPS18-PS3, GM6630, BRAFLDRAFT_114927, GM11361, RPS18P5 coding upstream 46455 441382 ~ 448780 (+)
CI01000321_00326486_00355049 NA coding upstream 140033 326393 ~ 355202 (+)
CI01000321_00283589_00284224 NA coding upstream 210898 283324 ~ 284337 (+)
CI01000321_00150756_00152124 NA coding upstream 343046 150756 ~ 152189 (+)
CI01000321_00098493_00100489 NA coding upstream 394649 98296 ~ 100586 (+)
CI01000321_00511077_00516356 NA coding downstream 15073 510554 ~ 516356 (+)
CI01000321_00549095_00550611 NA coding downstream 53614 549095 ~ 550648 (+)
CI01000321_00559268_00567811 NA coding downstream 63787 559268 ~ 568138 (+)
CI01000321_00649226_00658653 NA coding downstream 153745 649226 ~ 658950 (+)
CI01000321_00697882_00700283 CCK coding downstream 201585 697066 ~ 700313 (+)
G456798 NA non-coding upstream 1428 493340 ~ 493807 (+)
G456795 NA non-coding upstream 6926 487957 ~ 488309 (+)
G456793 NA non-coding upstream 7747 486803 ~ 487488 (+)
G456791 NA non-coding upstream 9373 485556 ~ 485862 (+)
G456775 NA non-coding upstream 91470 403372 ~ 403765 (+)
G456805 NA non-coding downstream 38949 534430 ~ 539694 (+)
G456806 NA non-coding downstream 49363 544844 ~ 545111 (+)
G456842 NA non-coding downstream 137243 632724 ~ 633919 (+)
G456867 NA non-coding downstream 221218 716699 ~ 718214 (+)
G456868 NA non-coding downstream 239706 735187 ~ 736481 (+)
G456774 NA other upstream 68210 426083 ~ 427025 (+)
CI01000321_00815160_00819665 NA other downstream 322983 815160 ~ 819749 (+)
CI01000321_03795430_03804685 SHISA7B, SHISA7 other downstream 3293837 3792915 ~ 3805511 (+)
CI01000321_04013470_04014515 CACNG8 other downstream 3511145 4013468 ~ 4015412 (+)
G459303 NA other downstream 3989916 4485397 ~ 4488552 (+)
CI01000321_04515562_04517953 MRPS21 other downstream 4020053 4515534 ~ 4518187 (+)

Expression


Co-expression Network