G463727



Basic Information


Item Value
gene id G463727
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000325
NCBI id null
chromosome length 10587162
location 2731499 ~ 2731721 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU532323
CTCGAACCCCGGCCCGATCGCTGCTGGCAGGCGAGGCAAGAGCACTAACAATGACGCTAAACACCACATTCTCTAGCGGTCATCAGTGTGCAGTGGTTTACCTGCACAACTCTCACTATCTAGCCACTGTTACACATGCAATGCGAGTTGATGCTGACGCGCAATAAAATGCTTCATGAAAAATAAAGCGCAGATGATGAACGAACGACAAGGAAGCACAAAA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU532323 True 223 lncRNA 0.49 1 2731499 2731721

Neighbor


gene id symbol gene type direction distance location
CI01000325_02618395_02618952 NA coding upstream 112419 2617406 ~ 2619080 (+)
CI01000325_02484476_02491983 KDR coding upstream 239273 2484476 ~ 2492226 (+)
CI01000325_02399892_02431492 NA coding upstream 300007 2399892 ~ 2431492 (+)
CI01000325_02211008_02215705 L3HYPDH coding upstream 515685 2209618 ~ 2215814 (+)
CI01000325_02067666_02085794 ESR2A, ESR2, ERBETA coding upstream 645705 2067666 ~ 2085794 (+)
CI01000325_02751187_02751618 NA coding downstream 18613 2750334 ~ 2751683 (+)
CI01000325_02767014_02793768 LNX1 coding downstream 33856 2762022 ~ 2794226 (+)
CI01000325_02834936_02881751 SCFD2 coding downstream 102695 2834416 ~ 2882034 (+)
CI01000325_02897237_02903784 NA coding downstream 164251 2895972 ~ 2903929 (+)
CI01000325_02968026_02987575 NA coding downstream 236305 2968026 ~ 2988001 (+)
G463725 NA non-coding upstream 2520 2728779 ~ 2728979 (+)
G463716 NA non-coding upstream 21843 2709277 ~ 2709656 (+)
G463709 NA non-coding upstream 55219 2675796 ~ 2676280 (+)
G463595 NA non-coding upstream 97629 2633640 ~ 2633870 (+)
G463569 NA non-coding upstream 100895 2591702 ~ 2630604 (+)
G463731 NA non-coding downstream 10927 2742648 ~ 2742902 (+)
G463771 NA non-coding downstream 300689 3032410 ~ 3033231 (+)
G463773 NA non-coding downstream 328064 3059785 ~ 3060011 (+)
G463776 NA non-coding downstream 354941 3086662 ~ 3086962 (+)
G463724 NA other upstream 3049 2728206 ~ 2728450 (+)
G463566 NA other upstream 167764 2563155 ~ 2563735 (+)
G462928 NA other upstream 730615 2000477 ~ 2000884 (+)
G462778 NA other upstream 834684 1828082 ~ 1896815 (+)
G462730 NA other upstream 1111305 1617596 ~ 1620194 (+)
G464950 NA other downstream 2326735 5058456 ~ 5090938 (+)
CI01000325_05549713_05553140 TMEM251 other downstream 2820399 5549713 ~ 5554577 (+)
CI01000325_05655953_05691697 PRIMA1 other downstream 2923691 5654840 ~ 5692630 (+)
G466144 NA other downstream 3767045 6498766 ~ 6501978 (+)
G466137 NA other downstream 3885479 6617200 ~ 6619471 (+)

Expression



Co-expression Network