G466307


Basic Information

Item Value
gene id G466307
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000325
NCBI id null
chromosome length 10587162
location 7030255 ~ 7030479 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU535279
CTGATGCGCAAGCTGATGATAATTACAGCGTTAAAGGGTTAGTTCACCCAAAAATGAAAATTCTGTCATTAATTACTCACCCTCATGTCGTTCTACACCAGTAAGACCTTCGTTCATCTTCTGAACACAAATTAAGATATTTTTGATGAAATCCGATGACTCAGTGAGGCCTCCATTGACAGCAATTTCACTGAACCTCTCAAGATCCATAAAGGTACTAAAGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU535279 True 225 lncRNA 0.39 1 7030255 7030479

Neighbor

gene id symbol gene type direction distance location
CI01000325_06968745_06969351 NA coding upstream 60284 6968745 ~ 6969971 (+)
CI01000325_06951886_06963827 FMN1 coding upstream 66413 6951819 ~ 6963842 (+)
CI01000325_06834601_06853645 NA coding upstream 176210 6834601 ~ 6854045 (+)
CI01000325_06825337_06828681 EMC7 coding upstream 201565 6825337 ~ 6828690 (+)
CI01000325_06820878_06823500 KATNBL1 coding upstream 206535 6820878 ~ 6823720 (+)
CI01000325_07037122_07051586 YWHAZ, 1433B, 143B2, YWHAQ, YWHAQA, YWHAQB, YWHABA, YWHABB, YWHAB coding downstream 6412 7036891 ~ 7051610 (+)
CI01000325_07053839_07064829 ADAM17 coding downstream 23360 7053839 ~ 7064851 (+)
CI01000325_07077438_07097577 ASAP2B, ASAP2, ASAP3 coding downstream 46959 7077438 ~ 7097999 (+)
CI01000325_07120140_07136417 MBOAT2B, MBOAT2 coding downstream 89661 7120140 ~ 7136501 (+)
CI01000325_07140324_07162617 KIDINS220B, KIDINS220 coding downstream 109845 7140324 ~ 7163663 (+)
G466237 NA non-coding upstream 32702 6993856 ~ 6997553 (+)
G466226 NA non-coding upstream 39795 6986571 ~ 6990460 (+)
G466293 NA non-coding upstream 56169 6971643 ~ 6974086 (+)
G466134 NA non-coding upstream 304506 6724388 ~ 6725749 (+)
G466133 NA non-coding upstream 314211 6601076 ~ 6716044 (+)
G466308 NA non-coding downstream 702 7031181 ~ 7031411 (+)
G466234 NA non-coding downstream 71103 7101582 ~ 7101927 (+)
G466330 NA non-coding downstream 161276 7191755 ~ 7192307 (+)
G466451 NA non-coding downstream 468139 7498618 ~ 7499239 (+)
G466452 NA non-coding downstream 468857 7499336 ~ 7499796 (+)
G466236 NA other upstream 25600 7003617 ~ 7004655 (+)
G466137 NA other upstream 410784 6617200 ~ 6619471 (+)
G466144 NA other upstream 528277 6498766 ~ 6501978 (+)
CI01000325_05655953_05691697 PRIMA1 other upstream 1336272 5654840 ~ 5692630 (+)
CI01000325_05549713_05553140 TMEM251 other upstream 1475678 5549713 ~ 5554577 (+)
G466227 NA other downstream 281604 7312083 ~ 7314812 (+)
G466219 NA other downstream 451557 7482036 ~ 7486407 (+)
G466752 NA other downstream 1543637 8574116 ~ 8575210 (+)
CI01000325_08732866_08734588 NA other downstream 1702035 8732514 ~ 8734758 (+)

Expression


Co-expression Network