G468440


Basic Information

Item Value
gene id G468440
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000325
NCBI id null
chromosome length 10587162
location 10518224 ~ 10518552 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU537670
GTTTGTGGATTGCTTGTCACATTAATGACTTCTGGCAGCAGTGCAATTTGAATAGGTGCCATGGCCATGTGAGCTATGTTCCCAGTGACAAAAAGGCAGCTGTATGTTCCTGACCAGTATCCATTTGTCTTCAGAAGTGTGACTGTTGATAATTCTGTACAAGTATCTGACAGCATTACTTCACTCCCTGGTCCCAGAATCAACGGCACGTCTTCGTCTCTGGACATCTGCCACACGCACTTGCTCATA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU537670 True 249 lncRNA 0.46 2 10518224 10518552

Neighbor

gene id symbol gene type direction distance location
CI01000325_10508690_10513563 MEP1A.2 coding upstream 4634 10508690 ~ 10513590 (+)
CI01000325_10503217_10508050 MEP1A.1 coding upstream 10023 10503217 ~ 10508201 (+)
CI01000325_10485430_10485761 NA coding upstream 32063 10485430 ~ 10486161 (+)
CI01000325_10476131_10483412 NA coding upstream 34756 10475815 ~ 10483468 (+)
CI01000325_10471174_10473656 SF3B6.S, BRAFLDRAFT_273506, PM14, SF3B6 coding upstream 44380 10471174 ~ 10473844 (+)
G468400 NA non-coding upstream 114768 10403192 ~ 10403456 (+)
G468377 NA non-coding upstream 282059 10233385 ~ 10236165 (+)
G468354 NA non-coding upstream 296003 10221991 ~ 10222221 (+)
G468349 NA non-coding upstream 309532 10207072 ~ 10208692 (+)
G468348 NA non-coding upstream 321194 10195365 ~ 10197030 (+)
G468453 NA non-coding downstream 54208 10572760 ~ 10573192 (+)
CI01000325_08732866_08734588 NA other upstream 1783672 8732514 ~ 8734758 (+)
G466752 NA other upstream 1943014 8574116 ~ 8575210 (+)
G466219 NA other upstream 3031817 7482036 ~ 7486407 (+)
G466227 NA other upstream 3203412 7312083 ~ 7314812 (+)
G466236 NA other upstream 3513569 7003617 ~ 7004655 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_018243 adgrf3b coding NC_007131.7 CM002904.2 35495687 ~ 35512932 (-)