G479610


Basic Information

Item Value
gene id G479610
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000338
NCBI id null
chromosome length 1590771
location 262275 ~ 262533 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU550410
GCAGATTTCATTTCATCATAATTAATTCTCAGAAAACGTCTAGAGAAAAATATTCAGAAATAAAAATAATACTGCTAATACAACATAATTTACATTTGCATTTTCCCGTGAGTTTAATACACTGAAATGATTATGACTGGCAAATGTTTATCAGTGAGGTAATTCTGAATTTATAAGGAATGTTATAACACGATGCATGTGGAGGTTTTTTTGGACGAAGGCTCTTTGGGATTATTGGCATCAGAATCTTCAACATCTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU550410 True 259 lncRNA 0.31 1 262275 262533

Neighbor

gene id symbol gene type direction distance location
CI01000338_00250239_00256775 NA coding upstream 5033 250239 ~ 257242 (+)
CI01000338_00230859_00245194 NA coding upstream 16951 230317 ~ 245324 (+)
CI01000338_00032989_00048218 NA coding upstream 212294 32989 ~ 49981 (+)
CI01000338_00263946_00292542 TNKS, TNKSA, TNKSB coding downstream 381 262914 ~ 292857 (+)
CI01000338_00296699_00309211 IDUA coding downstream 34166 296699 ~ 310064 (+)
CI01000338_00319884_00325330 RCHY1 coding downstream 57018 319551 ~ 325842 (+)
CI01000338_00361265_00364692 NA coding downstream 98732 361265 ~ 365670 (+)
CI01000338_00368482_00370906 NA coding downstream 105211 367744 ~ 371004 (+)
G479609 NA non-coding upstream 141 261930 ~ 262134 (+)
G479524 NA non-coding upstream 73988 187919 ~ 188287 (+)
G479491 NA non-coding upstream 75969 186068 ~ 186306 (+)
G479419 NA non-coding upstream 123678 135323 ~ 138597 (+)
G479532 NA non-coding downstream 15075 277608 ~ 311227 (+)
G479573 NA non-coding downstream 146169 408702 ~ 410172 (+)
CI01000338_00413456_00413785 TAL2 non-coding downstream 150585 413076 ~ 413787 (+)
G479624 NA non-coding downstream 168343 430876 ~ 431166 (+)
CI01000338_00424137_00425715 NA other downstream 162297 424039 ~ 426419 (+)
CI01000338_01376276_01378219 NA other downstream 1113741 1376274 ~ 1378387 (+)

Expression


Co-expression Network