G484122


Basic Information

Item Value
gene id G484122
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000339
NCBI id null
chromosome length 8057057
location 6938540 ~ 6939052 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU555485
CCTGTCCAAGTTGAGGAAGGTGCAGCATGAGCTGGAGGAAGCTGAAGAGCGTGCTGACATTGCTGAGTCTCAGGTCAACAAGCTCAGAGCCAAGAGCCGTGATGCTGGAAAGGCCAAGGAGGCGGAGTGAAACTCTTCATCTTACACCATTTTAATGTCTTTAAAAATGTAAAAAATAACACTAAATAAACTTTCATGCAGCAAATTCCTTTGGAATTCTGATTTCCTTCAATTCATTGCTGGTCAACACACAATATTAAAATGATGTTTATTAGTATTAAACTTTATAAAGAAACAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU555485 True 299 lncRNA 0.38 2 6938540 6939052

Neighbor

gene id symbol gene type direction distance location
CI01000339_06922495_06931270 NA coding upstream 7270 6922495 ~ 6931270 (+)
CI01000339_06908921_06911275 TESCB, TESC coding upstream 26752 6908921 ~ 6911788 (+)
CI01000339_06874834_06879285 ZMAT5 coding upstream 58537 6874834 ~ 6880003 (+)
CI01000339_06839905_06863576 SCAI coding upstream 74307 6839905 ~ 6864233 (+)
CI01000339_06823472_06827590 PPP6C.L, PPP6C, BRAFLDRAFT_113834 coding upstream 110276 6823472 ~ 6828264 (+)
CI01000339_06995644_07004684 NA coding downstream 56592 6995644 ~ 7004742 (+)
CI01000339_07075443_07080607 NDOR1 coding downstream 136265 7075317 ~ 7080632 (+)
CI01000339_07209025_07229708 NA coding downstream 269820 7208872 ~ 7229847 (+)
CI01000339_07234668_07235576 IER5L coding downstream 295424 7234476 ~ 7236787 (+)
CI01000339_07254028_07258117 CRAT, CRATA coding downstream 314976 7254028 ~ 7258632 (+)
G484090 NA non-coding upstream 65237 6867204 ~ 6873303 (+)
G484092 NA non-coding upstream 173560 6761688 ~ 6764980 (+)
G484081 NA non-coding upstream 194824 6740158 ~ 6743716 (+)
G483917 NA non-coding upstream 204362 6733770 ~ 6734178 (+)
G484045 NA non-coding upstream 243436 6633658 ~ 6695104 (+)
G484130 NA non-coding downstream 9429 6948481 ~ 6984216 (+)
G484129 NA non-coding downstream 70114 7009166 ~ 7011232 (+)
G484148 NA non-coding downstream 81596 7020648 ~ 7020999 (+)
G484154 NA non-coding downstream 115093 7054145 ~ 7054460 (+)
G484169 NA non-coding downstream 169058 7108110 ~ 7108952 (+)
CI01000339_06041909_06043927 ATP5L other upstream 894506 6041817 ~ 6044034 (+)
CI01000339_05599544_05600935 TIMM8B.S, TIMM8B other upstream 1336279 5599544 ~ 5602261 (+)
G483672 NA other upstream 1698756 5227323 ~ 5239784 (+)
CI01000339_03088452_03091633 NA other upstream 3848835 3088110 ~ 3091633 (+)
CI01000339_02821530_02821886 MRPL41 other upstream 4114647 2820576 ~ 2823479 (+)
G484139 NA other downstream 7334 6946386 ~ 6966146 (+)
G484134 NA other downstream 7741 6946793 ~ 6947480 (+)
G484172 NA other downstream 175531 7114583 ~ 7115459 (+)

Expression


Co-expression Network