G488184


Basic Information

Item Value
gene id G488184
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 2499596 ~ 2499844 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU560106
CAGGTTCCTCCAAAAAAAAGAAATGAGCAATGAAAAATTCCCTTTATCCATAAATTATATAGGAGTGTTGACACCTGTGTCATTTAAGGATGTTGTACAGAAAGTTTGCAAACCTGAATTTGTGCCTGTCGCTGTAAGAGGGCTCTCTGCACTGCTATCAGAGTACTGTCTCTTTGAGAAGAGGAAATACATCCTGCTGGAACAGAGTGGTGCTCCTCTCTTGATGACTCTGAACCCTCTCCACAAACC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU560106 True 249 lncRNA 0.42 1 2499596 2499844

Neighbor

gene id symbol gene type direction distance location
CI01000340_02341068_02348409 NA coding downstream 151119 2340503 ~ 2348477 (-)
CI01000340_02333476_02337529 AGXTA coding downstream 162067 2333102 ~ 2337529 (-)
CI01000340_02329631_02332000 DTYMK coding downstream 167596 2329606 ~ 2332000 (-)
CI01000340_02293072_02301920 STK25B, STK25, STK25A coding downstream 196649 2293014 ~ 2302947 (-)
CI01000340_02172629_02189732 HDLBP, HDLBPA coding downstream 309864 2171683 ~ 2189732 (-)
CI01000340_02567081_02567521 NA coding upstream 66893 2566737 ~ 2567643 (-)
CI01000340_02936853_02939837 BCL6A, BCL6 coding upstream 435793 2935637 ~ 2939837 (-)
CI01000340_03342324_03363204 TOMM70, TOMM70A coding upstream 842457 3342301 ~ 3363619 (-)
CI01000340_03379959_03401892 GFI1AB, GFI1 coding upstream 879442 3379286 ~ 3401952 (-)
CI01000340_03403238_03403692 NA coding upstream 903379 3403223 ~ 3403692 (-)
G488179 NA non-coding downstream 22336 2476955 ~ 2477260 (-)
G488147 NA non-coding downstream 72369 2405312 ~ 2427227 (-)
G487961 NA non-coding downstream 159717 2339538 ~ 2339879 (-)
G487957 NA non-coding downstream 160609 2338594 ~ 2338987 (-)
G487958 NA non-coding downstream 161105 2337889 ~ 2338491 (-)
G488186 NA non-coding upstream 338 2500182 ~ 2500405 (-)
G488187 NA non-coding upstream 1441 2501285 ~ 2501500 (-)
G488193 NA non-coding upstream 9063 2508907 ~ 2509117 (-)
G488196 NA non-coding upstream 11602 2511446 ~ 2511668 (-)
G488197 NA non-coding upstream 15259 2515103 ~ 2515304 (-)
G487884 NA other downstream 597324 1895801 ~ 1902272 (-)
CI01000340_00787534_00791061 NA other downstream 1708187 786551 ~ 791409 (-)
G485786 NA other downstream 2173880 325334 ~ 325716 (-)
CI01000340_00062787_00080635 NA other downstream 2417501 62780 ~ 82095 (-)
G488782 NA other upstream 1505961 4005805 ~ 4006448 (-)
G488862 NA other upstream 2007352 4507196 ~ 4518120 (-)
CI01000340_04598932_04627160 NA other upstream 2100376 4598714 ~ 4627447 (-)
CI01000340_05321995_05329778 ATG4C other upstream 2820909 5320753 ~ 5330215 (-)
CI01000340_06095704_06194498 MAST2 other upstream 3683446 6095704 ~ 6194501 (-)

Expression


Co-expression Network