G488384


Basic Information

Item Value
gene id G488384
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 2964298 ~ 2964585 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU560344
TGATGCAGTGCCATCTAAGGGCCCGAAGATCACGGGCATCCAGTAAGGTTTTCCGGCCTTGACCCTTACGCACAGAGATTGTTCCAGATTCTCTGAATCTTTGGATGATATTATGCACTGTATATGATGATAACTTCAAACTCTTTGCTATTTTTCTCTGAGAAACTCCTTTCTGATATTGCTCCACTATTTTTCGCCGCAGCATTGGGGGAATTGGTTATCCTCTGCCCATCTTGACTTCTGAGAGACACTGCCACTCTGAGAGGCTCTTTTTATACCCAATCATGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU560344 True 288 lncRNA 0.44 1 2964298 2964585

Neighbor

gene id symbol gene type direction distance location
CI01000340_02936853_02939837 BCL6A, BCL6 coding downstream 24461 2935637 ~ 2939837 (-)
CI01000340_02567081_02567521 NA coding downstream 396655 2566737 ~ 2567643 (-)
CI01000340_02341068_02348409 NA coding downstream 615821 2340503 ~ 2348477 (-)
CI01000340_02333476_02337529 AGXTA coding downstream 626769 2333102 ~ 2337529 (-)
CI01000340_02329631_02332000 DTYMK coding downstream 632298 2329606 ~ 2332000 (-)
CI01000340_03342324_03363204 TOMM70, TOMM70A coding upstream 377716 3342301 ~ 3363619 (-)
CI01000340_03379959_03401892 GFI1AB, GFI1 coding upstream 414701 3379286 ~ 3401952 (-)
CI01000340_03403238_03403692 NA coding upstream 438638 3403223 ~ 3403692 (-)
CI01000340_03406706_03449487 EVI5 coding upstream 441889 3406474 ~ 3449487 (-)
CI01000340_03474617_03478517 FAM69AB, FAM69A coding upstream 509375 3473960 ~ 3478517 (-)
G488341 NA non-coding downstream 18731 2943221 ~ 2945567 (-)
G488378 NA non-coding downstream 29643 2934342 ~ 2934655 (-)
G488334 NA non-coding downstream 35613 2925754 ~ 2928685 (-)
G488371 NA non-coding downstream 55679 2905985 ~ 2908619 (-)
G488359 NA non-coding downstream 106055 2855259 ~ 2858243 (-)
G488387 NA non-coding upstream 12506 2977091 ~ 2977767 (-)
G488388 NA non-coding upstream 13506 2978091 ~ 2978316 (-)
G488392 NA non-coding upstream 16759 2981344 ~ 3053730 (-)
G488395 NA non-coding upstream 56562 3021147 ~ 3044942 (-)
G488507 NA non-coding upstream 200747 3165332 ~ 3185994 (-)
G487884 NA other downstream 1062026 1895801 ~ 1902272 (-)
CI01000340_00787534_00791061 NA other downstream 2172889 786551 ~ 791409 (-)
G485786 NA other downstream 2638582 325334 ~ 325716 (-)
CI01000340_00062787_00080635 NA other downstream 2882203 62780 ~ 82095 (-)
G488782 NA other upstream 1041220 4005805 ~ 4006448 (-)
G488862 NA other upstream 1542611 4507196 ~ 4518120 (-)
CI01000340_04598932_04627160 NA other upstream 1635635 4598714 ~ 4627447 (-)
CI01000340_05321995_05329778 ATG4C other upstream 2356168 5320753 ~ 5330215 (-)
CI01000340_06095704_06194498 MAST2 other upstream 3218705 6095704 ~ 6194501 (-)

Expression


Co-expression Network