XLOC_014220


Basic Information

Item Value
gene id XLOC_014220
gene name NA
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007130.7
NCBI id CM002903.2
chromosome length 48449771
location 39750058 ~ 39752174 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00029729
tttacaactgcttaatgcagtactgatgtatctagtagttaagtgggtttaactaatgtcacatgtttttattcatttcagatgcagaaacttttgacatatgaattcatcttgactaaggaactcttcacagcactgcagctaaacagtcacaacctcacagagcagcacaactgccccactcagatcagtgttgaagctggaacctcatcttgtgtacagcaaaggcagagctgaaaattcactgtttgtcttgtattgtgtgtggcaaaacctggaataacacatgggagccctccaggaattgctgacactttacgcccaagtctcctcatgctaaccggattgcaatatgacagtctagtcagcataaacacctggactcaccaagcacactttggttctcagtgttttgtacaaattgtttttgctattcttcagtaaatacttgaatatgttttgaacttattctacttttgatgtttaagttcagaaagttgttattataaacataatttgcatttgtcatgaacttgacttcttgttgttgtgaaagctgtttattataatggcatttccaaaggcattatttgaaaatattttttgcagtgcagttttacttgagcttgacataccagatgtatgacatgaataaatatcacaaaataaatataataatg

Function

GO:

id name namespace
GO:0001711 endodermal cell fate commitment biological_process
GO:0001714 endodermal cell fate specification biological_process
GO:1903224 regulation of endodermal cell differentiation biological_process
GO:0010453 regulation of cell fate commitment biological_process
GO:0060795 cell fate commitment involved in formation of primary germ layer biological_process
GO:0035987 endodermal cell differentiation biological_process
GO:0042659 regulation of cell fate specification biological_process
GO:0042663 regulation of endodermal cell fate specification biological_process

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00029729 True 680 lncRNA 0.36 3 39750058 39752174

Neighbor

gene id symbol gene type direction distance location
XLOC_014219 NA coding upstream 334357 39409323 ~ 39415701 (+)
XLOC_014218 CT737129.1 coding upstream 456713 39275973 ~ 39293345 (+)
XLOC_014216 CABZ01045414.1 coding upstream 791011 38947629 ~ 38959047 (+)
XLOC_014217 CABZ01045413.1 coding upstream 801372 38948572 ~ 38948686 (+)
XLOC_014215 NA coding upstream 971297 38733094 ~ 38778761 (+)
XLOC_014221 BX957260.2 coding downstream 122657 39874831 ~ 39874947 (+)
XLOC_014222 BX957260.1 coding downstream 175232 39927406 ~ 39969458 (+)
XLOC_014223 sfpq coding downstream 273754 40025928 ~ 40055391 (+)
XLOC_014224 NA coding downstream 305662 40057836 ~ 40066591 (+)
XLOC_014225 zmym4 coding downstream 317350 40069524 ~ 40113935 (+)
XLOC_014230 NA non-coding downstream 576538 40328712 ~ 40333094 (+)
XLOC_014234 NA non-coding downstream 940254 40692428 ~ 40736984 (+)

Expression


Co-expression Network