XLOC_016120 (sst2)


Basic Information

Item Value
gene id XLOC_016120
gene name sst2
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 5726353 ~ 5728895 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00031825
ACACTTAGGGAGCAGAGTTCTGAGTTAAAGAAGCAGCAGAAATGGCCTCCTCGCAACTCCACCTGACAGCAACTCTTCTCTGTCTGGCCATGATGGCGGGCATCATATGTGGACGATCGCATATGCTCCTGAACTCTGCACTACAGGCGTCTCGCGGCACTTCTGCGGATGAAGAGATACCAGAGAGATACTCGCTTTCTGAGCTGGAGTGGCTGCTCAGTAACTCGGATCCGGCAGTTTTCCAGCCTGACAGCTCATCTCTGGGATCGCTACACAGTGGACTGGAGCTTATGAGAAGAGATACTAAAGAAGAGAGGAAGACCGGCTGCAAAAACTACTTCTGGAAATCCAGAACGGCATGCTAAAACTCGAAGTTACCAACATGCTGGCCATCATTTAGTCTTTCCTTTTCCTGAATCCAACACTCGTCATTTGCTGTCTTTTGAGTAATTTTAGACATTATCTGTGAAGAGTTTTCCACAGTCTCAGTATTATTTTGCTTTGAAGCATTGATTGCTTGCAATAAACTGAATACAGCA
>TCONS_00033764
TTCCACCCGTGGAGGTGCCACTATAAAATACCATTCAGAGGAGTAGAAAGAGACACTTAGGGAGCAGAGTTCTGAGTTAAAGAAGCAGCAGAAATGGCCTCCTCGCAACTCCACCTGACAGCAACTCTTCTCTGTCTGGCCATGATGGCGGGCATCATATGTGGACGATCGCATATGCTCCTGAACTCTGCACTACAGGCGTCTCGCGGCACTTCTGA

Function

symbol description
sst2 Predicted to enable hormone activity. Predicted to be involved in regulation of cell migration. Predicted to be located in extracellular region. Predicted to be active in extracellular space. Is expressed in brainstem; endocrine system; floor plate; and pleuroperitoneal region.

GO:

id name namespace
GO:0030334 regulation of cell migration biological_process
GO:0005576 extracellular region cellular_component
GO:0005615 extracellular space cellular_component
GO:0005179 hormone activity molecular_function

KEGG:

id description
ko04011 MAPK signaling pathway - yeast

ZFIN:

id description
ZDB-GENE-010219-2 Predicted to enable hormone activity. Predicted to be involved in regulation of cell migration. Predicted to be located in extracellular region. Predicted to be active in extracellular space. Is expressed in brainstem; endocrine system; floor plate; and pleuroperitoneal region.

Ensembl:

ensembl_id ENSDARG00000014190

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00031825 False 539 mRNA 0.46 2 5726353 5728843
TCONS_00033764 True 218 lncRNA 0.51 2 5726738 5728895

Neighbor

gene id symbol gene type direction distance location
XLOC_016119 cwc25 coding downstream 2567 5709424 ~ 5723786 (-)
XLOC_016118 NA coding downstream 23705 5701098 ~ 5702648 (-)
XLOC_016117 parla coding downstream 165334 5543901 ~ 5561019 (-)
XLOC_016116 cldn15la coding downstream 208915 5508542 ~ 5517438 (-)
XLOC_016115 saga coding downstream 221259 5480125 ~ 5505094 (-)
XLOC_016121 nyap2b coding upstream 5975 5734870 ~ 5776030 (-)
XLOC_016122 mier1b coding upstream 82587 5811482 ~ 5836116 (-)
XLOC_016123 NA coding upstream 110001 5838896 ~ 5840494 (-)
XLOC_016124 tmem125b coding upstream 205007 5933902 ~ 5942355 (-)
XLOC_016125 scp2a coding upstream 276304 6005199 ~ 6039757 (-)
XLOC_016113 NA non-coding downstream 272831 5449781 ~ 5453522 (-)
XLOC_016105 CU929154.1 non-coding downstream 912081 4812694 ~ 4814272 (-)
XLOC_016102 FO704866.1 non-coding downstream 1155250 4571013 ~ 4571103 (-)
XLOC_016100 NA non-coding downstream 1607538 4114011 ~ 4118815 (-)
XLOC_016138 CABZ01077605.1 non-coding upstream 1037398 6766293 ~ 6766407 (-)
XLOC_016139 CU694525.1 non-coding upstream 1146856 6875751 ~ 6919316 (-)
XLOC_016140 CU693440.1 non-coding upstream 1179767 6908662 ~ 6908681 (-)
XLOC_016141 AL953893.1 non-coding upstream 1351407 7080302 ~ 7080925 (-)

Expression


Co-expression Network