XLOC_016173 (zmp:0000001127)


Basic Information

Item Value
gene id XLOC_016173
gene name zmp:0000001127
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 9621289 ~ 9625548 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00031906
ATGTGTGAAATTGGTATTATGTGCTGTTTGCTGTGGCGCTGTGGTATCGCCGGTCCGGTCGGAGGGTTTAAATCTCCAGTTTTGGGTCTCACTGGAAAGGCGTGCAACCCGCTCGCGCGCTCTCTCCTCTGGAACGTGTCGGCTGTACTAGAGATGGACCATTTGTTCAGCGGGTTTGACTGCGCGCAGCAAAACGCAGAAGTTTACCTCAAGACGCAAACGGTGTCTGTCTGCACACCACAGAACTCCAACTGTGCTCAAAGTGCTATCGTAAATATAGATGAGAGCGAATGCCTACAGAGAATTCTGGAAGATCTCCACTACTATCGGGAAACATTTCTAGCCTACTCTAAACCTGAGCTCACCACAACTGTAGTCAGAGGCATTGAGGATGTCATGCAGAACTGTTTCTCTGTCTCTGTAACGGAGAATTCTCCAGCCAAGGCATCCATGGATCATCAAAAATCTTTTCAAGAACGACTGAAGCTGTGTAAAATCCTAAAGGGGTTCAGCCTTCGAGCAATAACAATCAATCGAGTTTTCAACTACATCTTGACAAAATAG

Function

symbol description
zmp:0000001127 Predicted to enable cytokine activity; growth factor activity; and interleukin-12 receptor binding activity. Predicted to act upstream of or within immune response. Predicted to be located in extracellular space.

GO:

id name namespace
GO:0006955 immune response biological_process
GO:0005576 extracellular region cellular_component
GO:0005615 extracellular space cellular_component
GO:0005125 cytokine activity molecular_function
GO:0005143 interleukin-12 receptor binding molecular_function
GO:0008083 growth factor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-140106-87 Predicted to enable cytokine activity; growth factor activity; and interleukin-12 receptor binding activity. Predicted to act upstream of or within immune response. Predicted to be located in extracellular space.

Ensembl:

ensembl_id ENSDARG00000067814

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00031906 True 564 mRNA 0.47 7 9621289 9625548

Neighbor

gene id symbol gene type direction distance location
XLOC_016172 txndc12 coding downstream 13410 9592319 ~ 9607879 (-)
XLOC_016171 slc25a24l coding downstream 77128 9529488 ~ 9544161 (-)
XLOC_016170 cope coding downstream 94079 9513160 ~ 9527210 (-)
XLOC_016168 st6galnac3 coding downstream 131678 9330146 ~ 9489611 (-)
XLOC_016169 CR385076.1 coding downstream 214614 9406558 ~ 9406675 (-)
XLOC_016174 zgc:153615 coding upstream 4010 9629558 ~ 9646857 (-)
XLOC_016175 selenot1a coding upstream 58757 9684305 ~ 9696283 (-)
XLOC_016176 CU633992.1 coding upstream 62507 9688055 ~ 9688185 (-)
XLOC_016177 dvl3a coding upstream 76505 9702053 ~ 9744081 (-)
XLOC_016178 NA coding upstream 120889 9746437 ~ 9748216 (-)
XLOC_016165 NA non-coding downstream 780405 8835922 ~ 8840884 (-)
XLOC_016162 CT027589.1 non-coding downstream 986157 8634240 ~ 8635132 (-)
XLOC_016159 NA non-coding downstream 1126573 8490588 ~ 8494716 (-)
XLOC_016156 NA non-coding downstream 1704902 7915351 ~ 7916387 (-)
XLOC_016181 BX470264.1 non-coding upstream 237285 9862833 ~ 9863388 (-)
XLOC_016199 CR450845.2 non-coding upstream 1279514 10905062 ~ 10905179 (-)
XLOC_016204 BX901918.3 non-coding upstream 1705176 11330724 ~ 11331316 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000003_01907347_01909263 NA coding CI01000003 null 1907122 ~ 1909600 (+)