XLOC_016249 (hccsa.2)


Basic Information

Item Value
gene id XLOC_016249
gene name hccsa.2
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 14982383 ~ 14987282 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00032032
GTGTTCCTCCTCAGAATGCCCAATGCATCAGGCATCTAAAGATCACACGAAGAAAGCTCCAGATGTACCTGCACATCAGGACAGGGCTTGTGAATTTGTGGAGTGTCCTATGAGAGCTGCCAATGGGACAAAACCCACACTGTCTGACATCAATCCAGCCAACATGATGCCTCCACCTAACCAGCAGCCTTCAGCTGATCAGCCCTTTCCCCTGTCAGTTGTAAGAGAGGAATCCACCATTCCCCGTGCTGGAGCTGAGCGGAACTGGGTTTATCCCTCAGAGCAGATGTTCTGGAATGCCATGCTGAGGAAAGGATGGCGCTGGAACAAAGGTGACATAAACCAGAACGATATGGGGGACATCATCAAGATTCACAATCAGAATAATGAACAAGCCTGGCAAGAAATCCTGAGATGGGAGAAACTCCATTCAAA

Function

symbol description
hccsa.2 Predicted to enable holocytochrome-c synthase activity. Predicted to be involved in cytochrome c-heme linkage. Predicted to be located in mitochondrial inner membrane. Predicted to be active in mitochondrion. Human ortholog(s) of this gene implicated in linear skin defects with multiple congenital anomalies 1 and microphthalmia. Orthologous to human HCCS (holocytochrome c synthase).

GO:

id name namespace
GO:0018063 cytochrome c-heme linkage biological_process
GO:0005743 mitochondrial inner membrane cellular_component
GO:0016020 membrane cellular_component
GO:0005739 mitochondrion cellular_component
GO:0046872 metal ion binding molecular_function
GO:0016829 lyase activity molecular_function
GO:0004408 holocytochrome-c synthase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-090501-4 Predicted to enable holocytochrome-c synthase activity. Predicted to be involved in cytochrome c-heme linkage. Predicted to be located in mitochondrial inner membrane. Predicted to be active in mitochondrion. Human ortholog(s) of this gene implicated in linear skin defects with multiple congenital anomalies 1 and microphthalmia. Orthologous to human HCCS (holocytochrome c synthase).

Ensembl:

ensembl_id ENSDARG00000095776

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00032032 True 435 mRNA 0.49 3 14982383 14987282

Neighbor

gene id symbol gene type direction distance location
XLOC_016248 NA coding downstream 18164 14962493 ~ 14964219 (-)
XLOC_016246 NA coding downstream 32757 14933798 ~ 14949626 (-)
XLOC_016247 CR788249.2 coding downstream 42380 14938586 ~ 14940003 (-)
XLOC_016243 NA coding downstream 151260 14737043 ~ 14831123 (-)
XLOC_016245 si:ch73-366i20.1 coding downstream 184078 14790294 ~ 14798305 (-)
XLOC_016250 CR788249.3 coding upstream 7111 14994393 ~ 14994490 (-)
XLOC_016251 hccsa.1 coding upstream 11330 14998612 ~ 15033163 (-)
XLOC_016252 si:dkey-10f21.4 coding upstream 47808 15035090 ~ 15041846 (-)
XLOC_016253 CR392002.1 coding upstream 114821 15102103 ~ 15107716 (-)
XLOC_016254 abcd3b coding upstream 122246 15109528 ~ 15125512 (-)
XLOC_016244 NA non-coding downstream 193136 14788783 ~ 14789247 (-)
XLOC_016258 NA non-coding upstream 649937 15637219 ~ 15650590 (-)
XLOC_016263 NA non-coding upstream 1515498 16502780 ~ 16506795 (-)
XLOC_016264 CR377211.4 non-coding upstream 1521542 16508824 ~ 16512422 (-)

Expression


Co-expression Network