XLOC_001795 (ora5)


Basic Information

Item Value
gene id XLOC_001795
gene name ora5
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007121.7
NCBI id CM002894.2
chromosome length 45420867
location 1590604 ~ 1591103 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00003593
ATGCAGCTCCAAGACTGGGTTGAATCCTCAATCCGAGCCTTTTTCTGCGTTACAGGCATCACTGGGAACTTCTGGCTGGCTCTGCGCTCTCTCCCTAGATCCAGATCCCGCTTGAGGCCGAATGACGTGCTCTTCATCAATCTGGCCGTCTCCAACCTCATCACCAACTGCATGGTGGACCTGCCGGACACTTTAGCGCAGTTTCTGAACAGCTGGCTGTTGAGCAGAAACTACTGCAGCGTGCTTCAGTTTTCATCAGACCTCTCGGAGACCAGCAGCATCTTCTCCACCATGTTCATCACCCTGTACTGGCACCAGAAGCTGGTGGGCTCCGTCCGGCGCGGTGGAGCCCCGGTGCAGCTGGACAATCTCCGGCTGGTGCTCTGGCTGCTGCTCGGGAGCTGGATGGTGGCGTTAACATTCAGCGTCCCTCACTTCTTCATAGCTGAACACGACGGAAATGACACTTTGGAAGTTTGTGAGGAAAAATTCCCAACTCC

Function

symbol description
ora5 Predicted to enable G protein-coupled receptor activity. Predicted to act upstream of or within G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in olfactory epithelium and olfactory receptor cell.

GO:

id name namespace
GO:0007186 G protein-coupled receptor signaling pathway biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0004930 G protein-coupled receptor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-100721-7 Predicted to enable G protein-coupled receptor activity. Predicted to act upstream of or within G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in olfactory epithelium and olfactory receptor cell.

Ensembl:

ensembl_id ENSDARG00000078257

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00003593 True 500 mRNA 0.55 1 1590604 1591103

Neighbor

gene id symbol gene type direction distance location
XLOC_001794 NA coding upstream 49872 1538299 ~ 1540732 (+)
XLOC_001793 gdnfa coding upstream 176443 1396940 ~ 1414161 (+)
XLOC_001792 unc5c coding upstream 483046 1052591 ~ 1107558 (+)
XLOC_001791 NA coding upstream 653562 859355 ~ 937042 (+)
XLOC_001790 CU694495.1 coding upstream 785245 805244 ~ 805359 (+)
XLOC_001796 sgsm1b coding downstream 47773 1638876 ~ 1675362 (+)
XLOC_001797 CU929183.1 coding downstream 73819 1664922 ~ 1665038 (+)
XLOC_001798 triap1 coding downstream 90415 1681518 ~ 1684882 (+)
XLOC_001799 NA coding downstream 106962 1698065 ~ 1713235 (+)
XLOC_001800 NA coding downstream 112802 1703905 ~ 1712770 (+)
XLOC_001789 NA non-coding upstream 793710 733787 ~ 796894 (+)
XLOC_001786 NA non-coding upstream 1047015 540293 ~ 543589 (+)
XLOC_001803 NA non-coding downstream 313252 1904355 ~ 1921020 (+)
XLOC_001804 NA non-coding downstream 375754 1966857 ~ 1991468 (+)

Expression


Co-expression Network