Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

model fish

XLOC_018377

Basic Information

Item	Value
gene id	XLOC_018377
gene name	NA
gene type	non-coding
species	zebrafish (Danio rerio)
category of species	model fish

Chromosome Information

Item	Value
chromosome id	NC_007131.7
NCBI id	CM002904.2
chromosome length	55201332
location	45852814 ~ 45854934 (-)
genome version	GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00036504
CTATTAATCAAACAGAAAACACATGAAGCATTGCAGGGCACCTTAATCTACCAAACTCTAAATCTGGCTCAAAGTCAGCCTTCCCATGCCTTAATTCAATATTCTGCCTGTAGATCCAAACCATGTGAATGAAGACTGAAGAGAAACTCAATGAGAGGAGACAGAGGTCCTGTTCAAAAGTAAATAACTCAGACCCTCTTCACTGACCCCTACGTTTTCCACA

Function

GO: NA

KEGG:

id	description
ko03230	Viral genome structure
ko05164	Influenza A
ko03200	Viral proteins

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TCONS_00036504	True	223	lncRNA	0.41	2	45852814	45854934

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
XLOC_018375	fermt1	coding	downstream	40662	45775935 ~ 45812152 (-)
XLOC_018374	trmt6	coding	downstream	80508	45754323 ~ 45772306 (-)
XLOC_018373	gpcpd1	coding	downstream	129919	45669176 ~ 45722895 (-)
XLOC_018372	napbb	coding	downstream	191761	45643823 ~ 45661053 (-)
XLOC_018371	NA	coding	downstream	292394	45551511 ~ 45560420 (-)
XLOC_018378	NA	coding	upstream	52213	45907147 ~ 45983660 (-)
XLOC_018379	NA	coding	upstream	187387	46042321 ~ 46042988 (-)
XLOC_018380	taar12j	coding	upstream	190801	46045735 ~ 46046758 (-)
XLOC_018381	taar12h	coding	upstream	197751	46052685 ~ 46053720 (-)
XLOC_018382	taar12e	coding	upstream	205701	46060635 ~ 46061650 (-)
XLOC_017928	CU539064.1	misc	downstream	35799113	10053405 ~ 10053701 (-)
XLOC_018370	NA	non-coding	downstream	429316	45368645 ~ 45423498 (-)
XLOC_018369	LO018355.1	non-coding	downstream	940483	44912213 ~ 44912331 (-)
XLOC_018365	NA	non-coding	downstream	1356569	44464345 ~ 44496245 (-)
XLOC_018363	BX664630.1	non-coding	downstream	1503757	44348942 ~ 44349057 (-)
XLOC_018393	NA	non-coding	upstream	302695	46157629 ~ 46159156 (-)
XLOC_018405	CU571074.1	non-coding	upstream	1028426	46883360 ~ 46883487 (-)
XLOC_018406	NA	non-coding	upstream	1094836	46949770 ~ 46953118 (-)

Expression

Co-expression Network