G5567


Basic Information

Item Value
gene id G5567
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 6792756 ~ 6809277 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU6979
tgagaggttattttccaggcaccacactcccagagccctcacctcctccctgtaggctgtctcatcaaatcaaatcaaatcaaattttatttgtcacatacacatggttagcagatgttaatgcgagtgtagcgaaatgcttgtgcttctagttccgacaatgcagtaataaccaacaagtaatctaactaacaattccaaaactactgtcttgtacacagtgtgaggggataaagaatatgtacataaggatatatgaat

Function

NR:

description
LOW QUALITY PROTEIN: transcription and mRNA export factor ENY2-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU6979 True 261 lncRNA 0.43 2 6792756 6809277

Neighbor

gene id symbol gene type direction distance location
b3gnt7 b3gnt7 coding upstream 92452 6684099 ~ 6700304 (+)
LOC110527749 armc9 coding upstream 140961 6559067 ~ 6651795 (+)
LOC110526525 LOC106613452 coding upstream 1025063 5664171 ~ 5767693 (+)
agxta LOC105025628 coding upstream 1835670 4948727 ~ 4957086 (+)
im:7152348 LOC106573986 coding upstream 2939747 3848517 ~ 3853009 (+)
alpi.1 LOC106574189 coding downstream 219273 7028550 ~ 7056518 (+)
alpi.2 LOC106574193 coding downstream 255091 7064368 ~ 7094220 (+)
ankle1 LOC106574192 coding downstream 287022 7096299 ~ 7107509 (+)
LOC118966183 NA coding downstream 521175 7330452 ~ 7331042 (+)
LOC110528450 LOC106574163 coding downstream 605336 7414613 ~ 7550394 (+)
G5366 NA non-coding upstream 43890 6748327 ~ 6748866 (+)
G5365 ncl non-coding upstream 45124 6742471 ~ 6747632 (+)
G5324 NA non-coding upstream 162977 6623804 ~ 6629779 (+)
G5304 NA non-coding upstream 212983 6578604 ~ 6579773 (+)
G5580 NA non-coding downstream 767 6810044 ~ 6810274 (+)
G5583 NA non-coding downstream 3231 6812508 ~ 6812775 (+)
G5669 NA non-coding downstream 76985 6886262 ~ 6886485 (+)
G5705 NA non-coding downstream 107175 6916452 ~ 6916713 (+)
G5712 NA non-coding downstream 112996 6922273 ~ 6922647 (+)
G5276 NA other upstream 274567 6517482 ~ 6518189 (+)
G3597 NA other upstream 1935691 4856525 ~ 4857065 (+)
G3596 NA other upstream 1936508 4854521 ~ 4856248 (+)
G3351 NA other upstream 2350848 4439966 ~ 4441908 (+)
G3234 NA other upstream 2393312 4398904 ~ 4399444 (+)
G5581 NA other downstream 1717 6810994 ~ 6811621 (+)
G6434 NA other downstream 915769 7725046 ~ 7725609 (+)
G6518 NA other downstream 1076114 7885391 ~ 7885907 (+)
G6807 NA other downstream 1227340 8036617 ~ 8037154 (+)
LOC110501328 LOC106574178 other downstream 1420020 8229189 ~ 8231566 (+)

Expression


Co-expression Network