LOC118936395 (rbm28)


Basic Information

Item Value
gene id LOC118936395
gene name rbm28
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 75584557 ~ 75585136 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>XR_005037885.1
GGAGGGCTTGGAGGAGGTGTTACTGCAGTATGGAGAACTGAAGTACATCAAGATCTGCCTACACCTAGACACTGAACACTCTAAAGGTATTGCCTTTGTTCAAGTTCAAGTCTAAAGAAGCAGCAGAGAAATGCATTGCTGCCGCAGAGGACGAGTCAGAGAGTGGGGGTATCCGTGTGGATGGTAGGAAGCTGAACATCGTAGCGGCGATAAGCAGAGAGGATGCCGTCAAACTGAAGGACAAGAAGGTCAAAACGCATACAGGGACCAGGAACCTCTACCTGGCTAGAGAGGGAT

Function

symbol description
rbm28 Predicted to enable RNA binding activity. Human ortholog(s) of this gene implicated in alopecia, neurologic defects, and endocrinopathy syndrome. Orthologous to human RBM28 (RNA binding motif protein 28).

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XR_005037885.1 True 297 mRNA 0.50 3 75584557 75585136

Neighbor

gene id symbol gene type direction distance location
LOC110501959 rbm28 coding downstream 2540 75578850 ~ 75582017 (-)
LOC110496174 LOC106561210 coding downstream 223315 75356571 ~ 75361242 (-)
LOC110496093 LOC106561201 coding downstream 990131 74533285 ~ 74594426 (-)
LOC118937295 NA coding downstream 1076452 74501414 ~ 74508105 (-)
LOC110496063 LOC106561200 coding downstream 1111241 74452532 ~ 74473316 (-)
LOC110496186 LOC106561212 coding upstream 10230 75595366 ~ 75607735 (-)
LOC110496199 LOC106561215 coding upstream 59205 75644341 ~ 75656164 (-)
LOC118942024 NA coding upstream 76624 75661760 ~ 75663665 (-)
LOC110501970 LOC106561217 coding upstream 103362 75688498 ~ 75701806 (-)
LOC110496262 LOC106561255 coding upstream 261405 75846541 ~ 75885181 (-)
G185113 lep non-coding downstream 16374 75566145 ~ 75568183 (-)
G185089 NA non-coding downstream 46009 75538314 ~ 75538548 (-)
G185082 NA non-coding downstream 53643 75530604 ~ 75530914 (-)
G185070 NA non-coding downstream 73161 75511099 ~ 75511396 (-)
G185062 LOC100136012 non-coding downstream 86959 75497354 ~ 75497598 (-)
G185091 NA non-coding upstream 51195 75636331 ~ 75731310 (-)
G185092 NA non-coding upstream 136708 75721844 ~ 75725317 (-)
G185951 NA non-coding upstream 211108 75796244 ~ 75796452 (-)
G185952 NA non-coding upstream 211441 75796577 ~ 75798109 (-)
G185985 NA non-coding upstream 257465 75842601 ~ 75843476 (-)
G184006 LOC106561202 other downstream 851920 74730872 ~ 74732637 (-)
G183538 NA other downstream 1473766 74106883 ~ 74110791 (-)
G183096 NA other downstream 1591012 73993078 ~ 73993545 (-)
G182882 NA other downstream 1908134 73676212 ~ 73676423 (-)
G182708 NA other downstream 2238710 73344950 ~ 73345847 (-)
G186002 NA other upstream 292223 75877359 ~ 75878060 (-)
tnni1c LOC106561253 other upstream 400023 75985156 ~ 75989573 (-)
adm2b adm2 other upstream 508034 76093170 ~ 76099909 (-)
G186197 LOC106561241 other upstream 688388 76273524 ~ 76293392 (-)

Expression


Co-expression Network