XLOC_021861 (mir196a-1)


Basic Information

Item Value
gene id XLOC_021861
gene name mir196a-1
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007134.7
NCBI id CM002907.2
chromosome length 46223584
location 36088091 ~ 36088196 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00043331
CGCGCGGCTGGTGCGTGGTTTAGGTAGTTTCATGTTGTTGGGATTGGCTTCCTGGCTCGACAACAAGAAACTGCCTTGATTACGTCAGTTCGTCTTCATCAAGGGC

Function

symbol description
mir196a-1 Predicted to enable translation repressor activity, mRNA regulatory element binding. Acts upstream of or within gene silencing by miRNA and pectoral fin development. Is expressed in central nervous system; neural tube; pronephric duct; and tail bud. Human ortholog(s) of this gene implicated in hepatocellular carcinoma. Orthologous to human MIR196A2 (microRNA 196a-2).

GO:

id name namespace
GO:0035278 miRNA mediated inhibition of translation biological_process
GO:0035279 mRNA cleavage involved in gene silencing by miRNA biological_process
GO:0033339 pectoral fin development biological_process
GO:0035195 gene silencing by miRNA biological_process
GO:0005575 cellular_component cellular_component
GO:0000900 translation repressor activity, mRNA regulatory element binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-MIRNAG-041217-14 Predicted to enable translation repressor activity, mRNA regulatory element binding. Acts upstream of or within gene silencing by miRNA and pectoral fin development. Is expressed in central nervous system; neural tube; pronephric duct; and tail bud. Human ortholog(s) of this gene implicated in hepatocellular carcinoma. Orthologous to human MIR196A2 (microRNA 196a-2).

Ensembl:

ensembl_id ENSDARG00000083309

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00043331 True 106 miRNA 0.52 1 36088091 36088196

Neighbor

gene id symbol gene type direction distance location
XLOC_021856 hoxc10a coding upstream 1196 35969228 ~ 36086895 (+)
XLOC_021859 hoxc11a coding upstream 9959 36074798 ~ 36078132 (+)
XLOC_021858 hoxc12a coding upstream 22909 36063599 ~ 36065182 (+)
XLOC_021857 hoxc13a coding upstream 32205 36052944 ~ 36055886 (+)
XLOC_021855 rarga coding upstream 124356 35847200 ~ 35963735 (+)
XLOC_021862 hoxc9a coding downstream 7064 36095260 ~ 36097488 (+)
XLOC_021863 hoxc8a coding downstream 12989 36101185 ~ 36103635 (+)
XLOC_021864 hoxc6a coding downstream 27345 36115541 ~ 36116907 (+)
XLOC_021865 hoxc5a coding downstream 30542 36118738 ~ 36120511 (+)
XLOC_021866 dre-mir-10b-2 coding downstream 41805 36130001 ~ 36130092 (+)
XLOC_021854 BX465853.1 non-coding upstream 289812 35790808 ~ 35798279 (+)
XLOC_021852 NA non-coding upstream 358029 35729255 ~ 35730062 (+)
XLOC_021851 NA non-coding upstream 360569 35723438 ~ 35727522 (+)
XLOC_021848 NA non-coding upstream 385370 35694272 ~ 35702721 (+)
XLOC_021845 NA non-coding upstream 527579 35557190 ~ 35560512 (+)
XLOC_021868 BX005254.2 non-coding downstream 62234 36150430 ~ 36154411 (+)
XLOC_021871 NA non-coding downstream 229153 36317349 ~ 36317913 (+)
XLOC_021872 NA non-coding downstream 230982 36319178 ~ 36319588 (+)
XLOC_021874 NA non-coding downstream 276709 36364905 ~ 36365917 (+)

Expression


Co-expression Network