XLOC_023384


Basic Information

Item Value
gene id XLOC_023384
gene name NA
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007135.7
NCBI id CM002908.2
chromosome length 42172926
location 18021574 ~ 18022214 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00046852
gtgaaaggtgggtaaaatatttattttgaactactatgcctggcatatccagataaaataaatattacagtgtatttatcaatgatacttttgcagcaaggaaagtgaaacttcagctagaccttgagttcagtttacaacatgaagatcctgctttcaacatctgatcaacacctgattttcatctgaggtaaaaaatagataagtaaatgaaacataataatattaatacattttttctagaattgtatattttgtggtgtgggtttgttttatgaaattctctcttgtttctttttgctgtttgcagagtaccaacatgttacaaatgagaattttccccacaaattctttgcacaactgaaccaccacctatttcatttgatgacaattttaaggcaaacagcatccaaaactggcaagacagcagattccctggctaatcttttaaaggtttatgatgagcaggaactgcatgatgtcaactcatgacggactactgttatcagaggtcttttggtcttgctgcgtgagcgtggcttaagattctttag
>TCONS_00046851
gtgaaaggtgggtaaaatatttattttgaactactatgcctggcatatccagataaaataaatattacagtgtatttatcaatgatacttttgcagcaaggaaagtgaaacttcagctagaccttgagttcagtttacaacatgaagatcctgctttcaacatctgatcaacacctgattttcatctgaggtaaaaaatagataaagtaccaacatgttacaaatgagaattttccccacaaattctttgcacaactgaaccaccacctatttcatttgatgacaattttaaggcaaacagcatccaaaactggcaagacagcagattccctggctaatcttttaaaggtttatgatgagcaggaactgcatgatgtcaactcatgacggactactgttatcagaggtcttttggtcttgctgcgtgagcgtggcttaagattctttag

Function

GO:

id name namespace
GO:0044085 cellular component biogenesis biological_process
GO:0016070 RNA metabolic process biological_process
GO:0016072 rRNA metabolic process biological_process
GO:0022613 ribonucleoprotein complex biogenesis biological_process
GO:0007517 muscle organ development biological_process
GO:0034470 ncRNA processing biological_process
GO:0006364 rRNA processing biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0031290 retinal ganglion cell axon guidance biological_process
GO:0006396 RNA processing biological_process
GO:0009880 embryonic pattern specification biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:0000154 rRNA modification biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:0010467 gene expression biological_process
GO:0042254 ribosome biogenesis biological_process
GO:0000469 cleavage involved in rRNA processing biological_process
GO:0000470 maturation of LSU-rRNA biological_process
GO:0042273 ribosomal large subunit biogenesis biological_process
GO:0043170 macromolecule metabolic process biological_process
GO:0061061 muscle structure development biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0031167 rRNA methylation biological_process
GO:0034660 ncRNA metabolic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0030684 preribosome cellular_component
GO:0030687 preribosome, large subunit precursor cellular_component
GO:1990904 ribonucleoprotein complex cellular_component
GO:0044428 obsolete nuclear part cellular_component
GO:0070013 intracellular organelle lumen cellular_component
GO:0005634 nucleus cellular_component
GO:0031974 membrane-enclosed lumen cellular_component
GO:0031981 nuclear lumen cellular_component
GO:0043228 non-membrane-bounded organelle cellular_component
GO:0043232 intracellular non-membrane-bounded organelle cellular_component
GO:0043233 organelle lumen cellular_component
GO:0005730 nucleolus cellular_component
GO:0003676 nucleic acid binding molecular_function
GO:0030515 snoRNA binding molecular_function
GO:0097159 organic cyclic compound binding molecular_function
GO:0003723 RNA binding molecular_function
GO:0140102 catalytic activity, acting on a rRNA molecular_function
GO:0008649 rRNA methyltransferase activity molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko05016 Huntington disease
ko03200 Viral proteins

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00046852 False 554 lncRNA 0.35 2 18021574 18022214
TCONS_00046851 True 449 lncRNA 0.37 3 18021574 18022214

Neighbor

gene id symbol gene type direction distance location
XLOC_023383 CR376742.1 coding downstream 474705 17546753 ~ 17546869 (-)
XLOC_023381 NA coding downstream 607628 17409308 ~ 17413946 (-)
XLOC_023380 NA coding downstream 615091 17403470 ~ 17406483 (-)
XLOC_023379 cul1b coding downstream 621102 17364745 ~ 17400472 (-)
XLOC_023378 NA coding downstream 785374 17233526 ~ 17236200 (-)
XLOC_023385 sec61g coding upstream 421975 18444189 ~ 18446604 (-)
XLOC_023386 zgc:112332 coding upstream 425894 18448108 ~ 18467064 (-)
XLOC_023387 si:dkey-73n8.3 coding upstream 447552 18469766 ~ 18485491 (-)
XLOC_023388 tnfrsf11a coding upstream 463652 18485866 ~ 18510631 (-)
XLOC_023389 relch coding upstream 498188 18520402 ~ 18685009 (-)
XLOC_023665 dre-mir-735 misc upstream 20155747 38177961 ~ 38178027 (-)
XLOC_023377 CR376737.1 non-coding downstream 882460 17136749 ~ 17139114 (-)
XLOC_023390 CR376786.1 non-coding upstream 603038 18625252 ~ 18625367 (-)
XLOC_023393 CR384092.1 non-coding upstream 1266440 19288654 ~ 19288768 (-)
XLOC_023395 NA non-coding upstream 1936702 19958916 ~ 19962882 (-)
XLOC_023397 CR381686.1 non-coding upstream 2010117 20032331 ~ 20054257 (-)
XLOC_023398 NA non-coding upstream 2038477 20060691 ~ 20063050 (-)

Expression


Co-expression Network