LOC110525492 (rpl35)


Basic Information

Item Value
gene id LOC110525492
gene name rpl35
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 22438886 ~ 22441136 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>XM_021605626.2
ATCCACTGAGTGGCGCTGTGGGCATTTTCACCGATACGCAACAAAAGGAACGCCTCGGACCGGAAGATAGCTTCTGAGCTAACACGTTGTCGGTCTTTCTTTTCCTGTGGCAGCAACGAGGAACATGGGCAAGATCAAGGCTAGAGATCTGCGGGGCAAGAAGAAGGAGGAGCTGCTCAAGCAGCTAGATGACCTGAAGGTAGAGCTGTCCCAGCTCCGTGTAGCCAAGGTTACTGGTGGAGCTGCCTCCAAGCTCTCCAAGATCTGTGTCGTCCGCAAGTCCATCGCCCGCGTTCTGACTGTCATCAACCAGACGCAGAAGGAGAACCTGAGGAAATTCTACAAGGGTAAAAAGTACAAGCCCCTGGATCTGAGACCCAGGAAGACCCGTGCCATCCGCAGGAGACTTAACAAGCATGAGGAGTCTCTCAGAACCAAGAAGATGCAGAGGAAGGAACGCCTGTATTCCATTCGCAAATTTGCTGTCAAGGCTTAAGGCTGTTTCTCTTGTACAAATAAATTGACTAAAAAGAGAA

Function

symbol description
rpl35 Predicted to enable mRNA binding activity. Predicted to be a structural constituent of ribosome. Acts upstream of or within chordate embryonic development; erythrocyte differentiation; and regulation of cell cycle. Predicted to be located in ribosome. Predicted to be part of cytosolic large ribosomal subunit. Human ortholog(s) of this gene implicated in Diamond-Blackfan anemia 19. Orthologous to human RPL35 (ribosomal protein L35).

NR:

description
unnamed protein product

GO:

id name namespace
GO:0006412 translation biological_process
GO:0005840 ribosome cellular_component
GO:0003735 structural constituent of ribosome molecular_function

KEGG:

id description
K02918 RP-L35e, RPL35; large subunit ribosomal protein L35e

RNA

RNA id representative length rna type GC content exon number start site end site
XM_021605626.2 True 536 mRNA 0.51 4 22438886 22441136

Neighbor

gene id symbol gene type direction distance location
nr6a1a LOC106585444 coding downstream 59887 22264623 ~ 22378999 (-)
nr5a1a LOC106585443 coding downstream 207484 22215815 ~ 22231402 (-)
tubb2b tubb2b coding downstream 544078 21892070 ~ 21894808 (-)
LOC110525119 LOC106585327 coding downstream 659724 21775601 ~ 21779162 (-)
LOC110525478 LOC106585434 coding downstream 674763 21745476 ~ 21764123 (-)
LOC110525493 LOC106585445 coding upstream 108 22441244 ~ 22457748 (-)
LOC110525495 LOC102784428 coding upstream 19633 22460769 ~ 22464361 (-)
LOC110525498 shlb2 coding upstream 109078 22550214 ~ 22572561 (-)
LOC110525497 LOC106585448 coding upstream 131650 22572786 ~ 22579398 (-)
LOC110525500 LOC106585450 coding upstream 152373 22593509 ~ 22617566 (-)
G485969 NA non-coding downstream 11758 22424226 ~ 22427128 (-)
G485959 NA non-coding downstream 31620 22406935 ~ 22407266 (-)
G485935 NA non-coding downstream 78330 22360190 ~ 22360556 (-)
G485930 NA non-coding downstream 84297 22353136 ~ 22354589 (-)
G485929 NA non-coding downstream 86936 22351724 ~ 22351950 (-)
G486024 NA non-coding upstream 73301 22514437 ~ 22514684 (-)
G486037 NA non-coding upstream 87349 22528485 ~ 22529833 (-)
G486573 NA non-coding upstream 99466 22540602 ~ 22540811 (-)
G486575 NA non-coding upstream 102227 22543363 ~ 22543636 (-)
G486586 NA non-coding upstream 138864 22580000 ~ 22580206 (-)
G485877 NA other downstream 157860 22280726 ~ 22281026 (-)
G485864 NA other downstream 175533 22260634 ~ 22263353 (-)
G485279 NA other downstream 604526 21833548 ~ 21834360 (-)
G484895 LOC106585423 other downstream 1004167 21431930 ~ 21434719 (-)
G484807 LOC106585304 other downstream 1140713 21296580 ~ 21298173 (-)
G486716 NA other upstream 396517 22837653 ~ 22840566 (-)
G486953 NA other upstream 810150 23251286 ~ 23258106 (-)
G487022 bicdl1 other upstream 944398 23385534 ~ 23385907 (-)
G487016 NA other upstream 948881 23390017 ~ 23392062 (-)
LOC110525180 hps4 other upstream 1141900 23582127 ~ 23587892 (-)

Expression


Co-expression Network