XLOC_025303 (mir196b)


Basic Information

Item Value
gene id XLOC_025303
gene name mir196b
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 23673377 ~ 23673455 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00049946
GTCTGTGATTTAGGTAGTTTCAAGTTGTTGGGCTGGACGTTTAATTTCACAGGAACCTGAAACTGCCTGAATTGCTCCA

Function

symbol description
mir196b Acts upstream of or within gene silencing by miRNA and pectoral fin development. Is expressed in neural tube and tail bud.

GO:

id name namespace
GO:0033339 pectoral fin development biological_process
GO:0035195 gene silencing by miRNA biological_process

KEGG:

id description
ko03100 Non-coding RNAs

ZFIN:

id description
ZDB-MIRNAG-081212-1 Acts upstream of or within gene silencing by miRNA and pectoral fin development. Is expressed in neural tube and tail bud.

Ensembl:

ensembl_id ENSDARG00000081346

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00049946 True 79 miRNA 0.43 1 23673377 23673455

Neighbor

gene id symbol gene type direction distance location
XLOC_025302 hoxb10a coding upstream 1514 23669267 ~ 23671863 (+)
XLOC_025301 NA coding upstream 5180 23665161 ~ 23668197 (+)
XLOC_025300 hoxb13a coding upstream 17543 23654233 ~ 23655834 (+)
XLOC_025299 NA coding upstream 56576 23604478 ~ 23616801 (+)
XLOC_025298 NA coding upstream 148727 23517959 ~ 23524650 (+)
XLOC_025304 hoxb9a coding downstream 3896 23677351 ~ 23682436 (+)
XLOC_025305 hoxb8a coding downstream 14454 23687909 ~ 23690481 (+)
XLOC_025306 hoxb7a coding downstream 18392 23691847 ~ 23696208 (+)
XLOC_025307 hoxb3a coding downstream 24542 23697997 ~ 23771945 (+)
XLOC_025308 hoxb6a coding downstream 30249 23703704 ~ 23705746 (+)
XLOC_025429 BX649540.1 misc downstream 6575284 30248739 ~ 30249036 (+)
XLOC_025296 NA non-coding upstream 261856 23406471 ~ 23411521 (+)
XLOC_025293 NA non-coding upstream 460048 23096442 ~ 23213329 (+)
XLOC_025311 dre-mir-10c non-coding downstream 47196 23720651 ~ 23720745 (+)
XLOC_025313 NA non-coding downstream 256991 23930446 ~ 23967966 (+)
XLOC_025316 dre-mir-152 non-coding downstream 422502 24095957 ~ 24096036 (+)
XLOC_025317 NA non-coding downstream 447746 24121201 ~ 24133485 (+)
XLOC_025319 CR790362.1 non-coding downstream 488414 24161869 ~ 24184426 (+)

Expression


Co-expression Network