XLOC_029990 (si:ch211-191d15.2)


Basic Information

Item Value
gene id XLOC_029990
gene name si:ch211-191d15.2
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007116.7
NCBI id CM002889.2
chromosome length 72500376
location 20441653 ~ 20442314 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00058706
GATCATGTCCCCTTGTCCCAATGGCTGCTGCTGTCCTCATCCTGGAGCTCTGGTTCTGTGCGAGTCTCTCGGTCTACACACTCTGCCTCGCTCTGTCCCTCTAAACACTGCTGTCCTCTCCGTAGCTCGGAATCGGCTCTGCAATGTGGACAACATGTTCCAGCCGTACTCAGGCCTGCAGGAGCTGAGCCTCAGCCACAACCAACTAGTCCGCTTCCCTCGTGGGCTTCCAGCGAGTCTGGAGACCCTTCAACTTCAGGAGAACCAGATCACTTACATCACCACTGGATCTCTAAGGCAGCTTGGGAACCTCACCCGTCTGGACTTGGAGGATAACCGGATACGGTCAGTTCAGCCGGGGGCACTGCTAAGTCTGACTAGACTGAGGATGTTAACTCTTAAGGGGAATAGATTGTCTCGTCTGCCAGCGAACTTACCTTCTTCGCTAACGCACCTTGATGTGTCAGAAAACTGTATATCTGCCCTGGATCTGTCCTCTTTGTTTATGCTGGTGAACCTACAAGTGTTAAGGATCAACAGTAACTGTTTACACACTATTCCTGAGCGGGCTTTTGATGGACTCTCCCACCTTCGCTCAGTAGATCTTGCCAATAATCTGTGGGTTTGCGAGTGTGAAATCATGTATCTGTATAGGTGGCTTC

Function

symbol description
si:ch211-191d15.2 Predicted to enable iron ion binding activity and iron-sulfur cluster binding activity. Predicted to be involved in neuron projection regeneration. Predicted to act upstream of or within iron-sulfur cluster assembly. Orthologous to human ISCU (iron-sulfur cluster assembly enzyme).

GO:

id name namespace
GO:0016226 iron-sulfur cluster assembly biological_process
GO:0031102 neuron projection regeneration biological_process
GO:0005506 iron ion binding molecular_function
GO:0051536 iron-sulfur cluster binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040724-113 Predicted to enable iron ion binding activity and iron-sulfur cluster binding activity. Predicted to be involved in neuron projection regeneration. Predicted to act upstream of or within iron-sulfur cluster assembly. Orthologous to human ISCU (iron-sulfur cluster assembly enzyme).

Ensembl:

ensembl_id ENSDARG00000092834

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00058706 True 662 mRNA 0.51 1 20441653 20442314

Neighbor

gene id symbol gene type direction distance location
XLOC_029989 tmem119a coding upstream 3870 20428838 ~ 20437783 (+)
XLOC_029988 selplg coding upstream 18112 20421539 ~ 20423541 (+)
XLOC_029987 coro1ca coding upstream 21790 20319519 ~ 20419863 (+)
XLOC_029986 ssh1a coding upstream 152361 20255568 ~ 20289292 (+)
XLOC_029985 svopa coding upstream 275965 20147830 ~ 20165688 (+)
XLOC_029991 sart3 coding downstream 11560 20453874 ~ 20481389 (+)
XLOC_029992 NA coding downstream 100586 20542900 ~ 20546489 (+)
XLOC_029993 cmklr1 coding downstream 128259 20570573 ~ 20590795 (+)
XLOC_029994 cmklrl2 coding downstream 157344 20599658 ~ 20600537 (+)
XLOC_029995 cmklrl2 coding downstream 171152 20613466 ~ 20614431 (+)
XLOC_029982 BX547941.1 non-coding upstream 363843 20077694 ~ 20077810 (+)
XLOC_029980 NA non-coding upstream 476370 19961795 ~ 19965283 (+)
XLOC_029972 NA non-coding upstream 1035715 19404532 ~ 19405938 (+)
XLOC_029971 NA non-coding upstream 1038275 19400399 ~ 19403378 (+)
XLOC_029966 NA non-coding upstream 1361737 19068184 ~ 19079916 (+)
XLOC_029996 BX510312.1 non-coding downstream 232619 20674933 ~ 20675050 (+)
XLOC_030005 BX470224.3 non-coding downstream 815904 21258218 ~ 21259238 (+)
XLOC_030006 BX470224.2 non-coding downstream 828136 21270450 ~ 21271359 (+)
XLOC_030007 BX470224.1 non-coding downstream 831851 21274165 ~ 21278501 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000339_00104544_00105929 NA coding CI01000339 null 103691 ~ 106266 (+)