XLOC_003138 (mir196c)



Basic Information


Item Value
gene id XLOC_003138
gene name mir196c
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information


Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 2190621 ~ 2190730 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence


>TCONS_00006199
CCCGTCCAGCTGATGCGTGGTTTAGGTAGTTTGATGTTGTTGGGGTTGACTTCCTGGCTCGACAACAAGAAACTGCCTTGATTACGTCAGTTTGCCTTCATCAAGGCCGT

Function


symbol description
mir196c Predicted to enable translation repressor activity, mRNA regulatory element binding. Predicted to act upstream of or within mRNA cleavage involved in gene silencing by miRNA and miRNA mediated inhibition of translation. Is expressed in neural tube and tail bud. Human ortholog(s) of this gene implicated in hepatocellular carcinoma. Orthologous to human MIR196A2 (microRNA 196a-2).

GO:

id name namespace
GO:0035278 miRNA mediated inhibition of translation biological_process
GO:0035279 mRNA cleavage involved in gene silencing by miRNA biological_process
GO:0005575 cellular_component cellular_component
GO:0000900 translation repressor activity, mRNA regulatory element binding molecular_function

KEGG:

id description
ko03100 Non-coding RNAs

ZFIN:

id description
ZDB-MIRNAG-050712-1 Predicted to enable translation repressor activity, mRNA regulatory element binding. Predicted to act upstream of or within mRNA cleavage involved in gene silencing by miRNA and miRNA mediated inhibition of translation. Is expressed in neural tube and tail bud. Human ortholog(s) of this gene implicated in hepatocellular carcinoma. Orthologous to human MIR196A2 (microRNA 196a-2).

Ensembl:

ensembl_id ENSDARG00000106838

RNA


RNA id representative length rna type GC content exon number start site end site
TCONS_00006199 True 110 miRNA 0.50 1 2190621 2190730

Neighbor


gene id symbol gene type direction distance location
XLOC_003137 hoxc11b coding upstream 5447 2180072 ~ 2185174 (+)
XLOC_003136 hoxc12b coding upstream 15588 2172335 ~ 2175033 (+)
XLOC_003135 hoxc13b coding upstream 27800 2156430 ~ 2162821 (+)
XLOC_003134 rargb coding upstream 94152 2089461 ~ 2096469 (+)
XLOC_003132 NA coding upstream 193211 1935684 ~ 1997410 (+)
XLOC_003139 NA coding downstream 7800 2198530 ~ 2205798 (+)
XLOC_003140 NA coding downstream 117479 2308209 ~ 2320355 (+)
XLOC_003141 igfbp6a coding downstream 200739 2391469 ~ 2397974 (+)
XLOC_003142 pip4k2cb coding downstream 208113 2398843 ~ 2413107 (+)
XLOC_003143 ube2v1 coding downstream 225334 2416064 ~ 2429303 (+)
XLOC_003250 BX324177.11 misc downstream 9155073 11345803 ~ 11346099 (+)
XLOC_003255 BX324177.14 misc downstream 9182156 11372886 ~ 11373182 (+)
XLOC_003257 BX324177.13 misc downstream 9195632 11386362 ~ 11386658 (+)
XLOC_003260 BX324177.2 misc downstream 9227303 11418033 ~ 11418323 (+)
XLOC_003262 BX324177.15 misc downstream 9238663 11429393 ~ 11429689 (+)
XLOC_003133 NA non-coding upstream 238027 1951631 ~ 1952594 (+)
XLOC_003126 AL935272.1 non-coding upstream 644390 1546117 ~ 1546231 (+)
XLOC_003118 FQ311892.1 non-coding upstream 1459698 730807 ~ 730923 (+)
XLOC_003112 NA non-coding upstream 1646427 543348 ~ 544194 (+)
XLOC_003149 FQ790208.1 non-coding downstream 424340 2615070 ~ 2616023 (+)
XLOC_003156 CT583672.1 non-coding downstream 636823 2827553 ~ 2828675 (+)
XLOC_003159 dre-mir-724 non-coding downstream 985956 3176686 ~ 3176770 (+)

Expression



Co-expression Network