G1362420



Basic Information


Item Value
gene id G1362420
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 30440157 ~ 30440414 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1557011
cttaaaatgttttattgcgaaaacaaatcaaatcaaatcaaattttatttgtcacatacacatggttagcagatgttaatgggagtgtagcgaaatgcttgtgcttctagttccgtcaatgcagtaataacaagtaatctaactaacaattccaaaactactgtcttgtacacagtgtaaggggataaagaatatgtacataaggatatatgaatgagtgatggtacagagcagcataggcaagatacagtagatggt

Function


NR:

description
LOW QUALITY PROTEIN: transcription and mRNA export factor ENY2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1557011 True 258 lncRNA 0.34 1 30440157 30440414

Neighbor


gene id symbol gene type direction distance location
LOC110492894 NA coding downstream 566575 29855177 ~ 29873630 (-)
LOC110491798 LOC106578369 coding downstream 737564 29674817 ~ 29702593 (-)
LOC110491794 NA coding downstream 1016504 29412470 ~ 29423653 (-)
afap1l2 afap1l2 coding downstream 1673155 28626132 ~ 28767002 (-)
LOC110491790 LOC100194624 coding downstream 1899512 28535317 ~ 28540645 (-)
LOC110491806 LOC106579428 coding upstream 484191 30924605 ~ 31019315 (-)
LOC110492870 ate1 coding upstream 689703 31130117 ~ 31182991 (-)
LOC110491809 p5cs coding upstream 830195 31270609 ~ 31285633 (-)
LOC110491810 LOC106579441 coding upstream 864669 31305083 ~ 31307541 (-)
LOC110491807 LOC106576884 coding upstream 873680 31314091 ~ 31462245 (-)
G1362419 NA non-coding downstream 15 30439861 ~ 30440142 (-)
G1362349 NA non-coding downstream 96460 30343496 ~ 30343697 (-)
G1362338 NA non-coding downstream 110539 30329406 ~ 30329618 (-)
G1362337 NA non-coding downstream 113854 30326026 ~ 30326303 (-)
G1362320 NA non-coding downstream 142037 30297778 ~ 30298120 (-)
G1362426 NA non-coding upstream 9823 30450237 ~ 30450520 (-)
G1362433 NA non-coding upstream 20405 30460819 ~ 30461051 (-)
G1362434 NA non-coding upstream 20912 30461326 ~ 30461853 (-)
G1362436 NA non-coding upstream 23810 30464224 ~ 30464940 (-)
G1362474 NA non-coding upstream 74765 30515179 ~ 30538065 (-)
G1361619 NA other downstream 515003 29923871 ~ 29925154 (-)
G1361290 NA other downstream 942602 29497113 ~ 29497555 (-)
taok2b LOC106579406 other downstream 2259217 28177715 ~ 28237354 (-)
G1359763 NA other downstream 2275930 28163463 ~ 28164227 (-)
G1359412 NA other downstream 2912020 27527163 ~ 27528137 (-)
G1363836 NA other upstream 1199023 31639437 ~ 31650697 (-)
G1364105 NA other upstream 1445335 31885749 ~ 31886112 (-)
G1364348 NA other upstream 1578380 32018794 ~ 32019498 (-)
G1365099 NA other upstream 2194051 32634465 ~ 32635511 (-)
G1366703 NA other upstream 3243597 33684011 ~ 33684473 (-)

Expression



Co-expression Network