G2087664



Basic Information


Item Value
gene id G2087664
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048591.1
NCBI id CM023245.2
chromosome length 51556237
location 46545496 ~ 46545889 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2387757
GATCTTTAGGAGGGCTTTGTGTACGTGGATACACTTTCCATCCACAAGGAACTTGAGATCTGAGATGTCCGGGCTGTCAAACTCCCTCTTCAGAGACTGGGCCACCGTCAGATAGTCATCACCGTCTGAATAACACAGACCAAAAAAATCAGTCAGTCCTCTAAAAGAGGCCAGAGCAACGAAAACACTCAAACCCATTGGAAATACTTAAAATAGTATCTGATCCCAGGTCTGTAACCATCATCACATCCTGTACAGCCTCAGTCTTACCCACGGTTGAGGAGGTGTGTCAGTCTTACCCACGGTTGAGGAGGTGTGTCAGTCTTACCCACGGTTGAGG

Function


NR:

description
PREDICTED: RCC1 and BTB domain-containing protein 2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2387757 True 340 lncRNA 0.48 2 46545496 46545889

Neighbor


gene id symbol gene type direction distance location
nek3 nek3 coding upstream 134329 46375319 ~ 46411167 (+)
LOC118944693 NA coding upstream 190844 46351995 ~ 46354652 (+)
LOC110508109 LOC105029023 coding upstream 195929 46203597 ~ 46349567 (+)
foxo1a LOC106581554 coding upstream 753701 45703165 ~ 45791795 (+)
cysltr2b LOC106581558 coding downstream 27332 46573221 ~ 46576187 (+)
fndc3a LOC106581557 coding downstream 33731 46579620 ~ 46761993 (+)
LOC118944696 NA coding downstream 197107 46742996 ~ 46745025 (+)
mlnr LOC106581570 coding downstream 228523 46774412 ~ 46783031 (+)
zgc:153184 LOC106581572 coding downstream 276038 46821927 ~ 46897922 (+)
G2087659 NA non-coding upstream 9368 46535508 ~ 46536128 (+)
G2087654 NA non-coding upstream 19981 46510111 ~ 46525515 (+)
G2087656 NA non-coding upstream 20144 46511535 ~ 46525352 (+)
G2087655 NA non-coding upstream 28338 46516175 ~ 46517158 (+)
G2087592 LOC106592078 non-coding upstream 45999 46493922 ~ 46499497 (+)
G2087704 NA non-coding downstream 90731 46636620 ~ 46637423 (+)
G2087756 NA non-coding downstream 163019 46708908 ~ 46709880 (+)
G2087799 NA non-coding downstream 271204 46817093 ~ 46820232 (+)
G2087812 NA non-coding downstream 296166 46842055 ~ 46848568 (+)
G2087569 NA other upstream 221802 46323084 ~ 46323694 (+)
G2087149 NA other upstream 746903 45797099 ~ 45798593 (+)
mtus2b LOC106593344 other upstream 1015557 45493223 ~ 45664305 (+)
LOC110508103 LOC106581548 other upstream 1057759 45480328 ~ 45487737 (+)
G2087865 NA other downstream 481230 47027119 ~ 47028563 (+)
prcp prcp other downstream 491153 47020501 ~ 47056921 (+)
G2088729 NA other downstream 979551 47525440 ~ 47528548 (+)
G2088732 NA other downstream 986533 47532422 ~ 47537945 (+)
G2088870 NA other downstream 1308217 47854106 ~ 47864829 (+)

Expression



Co-expression Network