G2089931


Basic Information

Item Value
gene id G2089931
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048591.1
NCBI id CM023245.2
chromosome length 51556237
location 49052146 ~ 49052369 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2390644
gtctataaggtagtagttttggaattgttagctagattacttggtggttattactgcattgtcggaactagaagcacaagcatttcgctacactcgcattaacatctgctaaccatgtgtatgtgacaaataaaatttgatttgatttgatttgagctagtggaaagccttcccagaagaatggaggctgttatagcagaaatgttccaacatctacttgaaag

Function

NR:

description
LOW QUALITY PROTEIN: transcription and mRNA export factor ENY2-like

GO: NA

KEGG:

id description

RNA

RNA id representative length rna type GC content exon number start site end site
TU2390644 True 224 lncRNA 0.38 1 49052146 49052369

Neighbor

gene id symbol gene type direction distance location
zmp:0000001236 LOC106581583 coding upstream 277465 48633372 ~ 48774681 (+)
gab2 gab2 coding upstream 427698 48460449 ~ 48624448 (+)
nars2 nars2 coding upstream 593707 48401253 ~ 48458439 (+)
tenm4 tenm4 coding upstream 733061 47640597 ~ 48319085 (+)
LOC118944690 NA coding upstream 1569112 47482390 ~ 47483034 (+)
trpc6b LOC106581586 coding downstream 37514 49089883 ~ 49186113 (+)
pgr LOC100846969 coding downstream 149079 49201448 ~ 49266635 (+)
LOC118944717 NA coding downstream 270644 49323013 ~ 49323866 (+)
LOC110508133 fbxo40 coding downstream 1413514 50465883 ~ 50476608 (+)
LOC110507254 nectin1 coding downstream 1613350 50665719 ~ 50850459 (+)
G2089930 NA non-coding upstream 99 49051765 ~ 49052047 (+)
G2089927 NA non-coding upstream 6771 49045149 ~ 49045375 (+)
G2089922 NA non-coding upstream 24836 49027088 ~ 49027310 (+)
G2089904 NA non-coding upstream 127834 48923862 ~ 48924312 (+)
G2089903 NA non-coding upstream 128331 48923581 ~ 48923815 (+)
G2089937 NA non-coding downstream 11721 49064090 ~ 49064458 (+)
G2089983 NA non-coding downstream 26084 49078453 ~ 49078657 (+)
G2090001 NA non-coding downstream 46935 49099304 ~ 49099878 (+)
G2090010 NA non-coding downstream 57058 49109427 ~ 49109670 (+)
G2090025 NA non-coding downstream 70362 49122731 ~ 49122979 (+)
G2089906 NA other upstream 124854 48926975 ~ 48927292 (+)
G2089124 NA other upstream 596660 48432478 ~ 48455486 (+)
G2089020 NA other upstream 860784 48188209 ~ 48191362 (+)
G2088870 NA other upstream 1187317 47854106 ~ 47864829 (+)
G2088732 NA other upstream 1514201 47532422 ~ 47537945 (+)
G2089935 NA other downstream 5636 49058005 ~ 49058895 (+)
G2090091 LOC106581584 other downstream 260374 49312743 ~ 49316226 (+)
G2090103 NA other downstream 281078 49333447 ~ 49334183 (+)
G2090508 NA other downstream 732758 49782101 ~ 49788805 (+)

Expression


Co-expression Network