G90218


Basic Information

Item Value
gene id G90218
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053119.1
NCBI id CM020916.1
chromosome length 42187026
location 36255175 ~ 36255566 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU121443
AGCTCGAGTCATTACCAAAACTCGCATTTTTGAACACATTTCTCCTGTTTTACAGAAGTTGCATTGGCTCCCGGTTAAATTCCGTTTAGATTTTAAAGTTTTGCTTTTAACTTACAAAGCACTTAACAATTTGGCTCCTTCATATCTTCAAGATCTTCTTCATATTCATACTCCTTCCCGCACTCTAAGATCTGCTTCTGTACTTACACTTGTTCTGCCATGCACTAGGACAGCTTCTATGGGGTCACGAGCTTTTGGCTATGCTGCTCCCCATTTATGGAACTCTCTTCCTGTGGAAGTTCGAAACAGTTCTAGTCTCTCAGTTTTTAAATCTCGTCTTAAAACGTATCTGTTTAGGCAGGCTTTTATGTGATTAATGTTTGATGCTGTAC

Function

GO:

id name namespace
GO:0005507 copper ion binding molecular_function

KEGG:

id description
ko04610 Complement and coagulation cascades

RNA

RNA id representative length rna type GC content exon number start site end site
TU121443 True 392 lncRNA 0.39 1 36255175 36255566

Neighbor

gene id symbol gene type direction distance location
siah1 siah1,LOC102794717 coding upstream 148725 36065628 ~ 36106450 (+)
n4bp1 n4bp1,LOC101465464 coding upstream 206764 36018268 ~ 36048411 (+)
cbln1 cbln1,LOC104949597 coding upstream 561470 35659713 ~ 35693705 (+)
si:ch211-212o1.2 LOC103358434,LOC100695703,LOC102310624 coding upstream 668634 35512384 ~ 35586541 (+)
znf423 znf423 coding upstream 747891 35338892 ~ 35507284 (+)
st3gal2 st3gal2,LOC102780992 coding downstream 113195 36368761 ~ 36390263 (+)
exosc6 exosc6 coding downstream 173936 36429502 ~ 36431389 (+)
tgm2l LOC103363999,LOC104953692,LOC102308322 coding downstream 189527 36445093 ~ 36458111 (+)
trnal-cag_1 NA coding downstream 207920 36463486 ~ 36463568 (+)
LOC120564167 NA coding downstream 210129 36465695 ~ 36489643 (+)
G90217 NA non-coding upstream 352 36254401 ~ 36254823 (+)
LOC120563515 NA non-coding upstream 14177 36240148 ~ 36240998 (+)
LOC120564233 NA non-coding upstream 66905 36185963 ~ 36188270 (+)
G90162 NA non-coding upstream 146913 36107745 ~ 36108262 (+)
G90161 NA non-coding upstream 147684 36107043 ~ 36107491 (+)
G90236 NA non-coding downstream 57148 36312714 ~ 36368430 (+)
G90238 NA non-coding downstream 96744 36352310 ~ 36358218 (+)
G90241 aars,LOC102788534 non-coding downstream 141725 36397291 ~ 36400070 (+)
LOC120563368 NA non-coding downstream 338590 36594156 ~ 36595693 (+)
G90311 NA non-coding downstream 466359 36721925 ~ 36722827 (+)
G90142 NA other upstream 469759 35784694 ~ 35785416 (+)
LOC120563677 gnao1,LOC103367675,LOC108249535,LOC107660763,LOC100693875 other upstream 1264763 34847563 ~ 34990412 (+)
G89836 NA other upstream 1819858 34434089 ~ 34435317 (+)
G89813 NA other upstream 1833994 34381836 ~ 34421181 (+)
G89811 LOC100698998 other upstream 1892798 34360484 ~ 34362377 (+)
anapc13 anapc13 other downstream 260445 36516011 ~ 36517921 (+)
mt2 NA other downstream 275407 36530973 ~ 36531996 (+)
wfdc1 wfdc1,LOC102778323 other downstream 1766811 38022377 ~ 38034694 (+)
G90583 NA other downstream 1798943 38054509 ~ 38055564 (+)
G90686 NA other downstream 2402800 38658366 ~ 38680087 (+)

Expression


Co-expression Network