G93700 (atpaf1,LOC102780159)


Basic Information

Item Value
gene id G93700
gene name atpaf1,LOC102780159
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053120.1
NCBI id CM020917.1
chromosome length 41568296
location 6390156 ~ 6398997 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU126433
AGGCAGAGCGTAGAGGAACATCGGGCACGACTTGGATCTGCTCAGTATCACCTCGTACATCTGTGTCGGGATCACGGCGCTGATTGTGTCCTTGGTCGAATAATATTTCATCCAAAGCTCTGCAATCTCCTCGCCAGTCTTGTCCGCGATCATCTCCAGGTTCAGGATGGAGTCCAGCGTCTTGTTCTTTGTGAAACCTCCGGACGCTCCCTCGCCGGCAGCCATCTTGTCCCTTTTCTCCAACTCCTGCTCCATGAGCCTGACGAACTCCGCCTGTTTTGAGTGTCCCAGCACTTCCTTCTTGGCCTCATGACTTTTCTCCACTCGGGCCTTGAACTCCTGGGGTTTGGCGCTGCGCAGCTTCTGGATCTTGTCCTGGTACTTGTTGTAGTACGGGTTCTGCTCCAGCTCCGGCTCCTTCCGCAATGAGAAGGCTCGGAAGTGCGCCGGGACCAGCCCGGGGATCAGCGTCCTGATGCCGGTGGCCCTGACCGCTAACATCCCCCGGTACAAACAAGACATCTGTACGATGGCCGCCGCCATCTTTCCATCGCTCCC

Function

symbol description
atpaf1 Predicted to be involved in mitochondrial proton-transporting ATP synthase complex assembly. Predicted to act upstream of or within protein-containing complex assembly. Predicted to be active in mitochondrion. Is expressed in immature eye and optic tectum. Orthologous to human ATPAF1 (ATP synthase mitochondrial F1 complex assembly factor 1).

NR:

description
PREDICTED: ATP synthase mitochondrial F1 complex assembly factor 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU126433 True 558 lncRNA 0.57 7 6390156 6398997

Neighbor

gene id symbol gene type direction distance location
LOC120565762 LOC102311032 coding upstream 45075 6335751 ~ 6345081 (+)
tut4 zcchc11 coding upstream 100037 6262220 ~ 6290119 (+)
LOC120565748 NA coding upstream 318909 6067683 ~ 6071247 (+)
LOC120565642 tspan1,LOC104930558 coding upstream 360963 6002811 ~ 6029193 (+)
mast2 mast2,LOC102294889,LOC102799744 coding upstream 903271 5211170 ~ 5486885 (+)
cyldl NA coding downstream 228645 6627642 ~ 6641120 (+)
ghrhrb LOC100710271,LOC101475240,LOC103357300 coding downstream 273074 6672071 ~ 6723277 (+)
si:ch211-191a24.4 LOC104966872 coding downstream 566550 6965547 ~ 6971300 (+)
si:ch211-191a24.3 LOC103358916 coding downstream 608173 7007170 ~ 7067934 (+)
igfbp3 LOC103358919 coding downstream 709152 7108149 ~ 7127272 (+)
G93644 NA non-coding upstream 147998 6241195 ~ 6242158 (+)
G93640 NA non-coding upstream 174421 6215068 ~ 6215735 (+)
G93609 NA non-coding upstream 425097 5964812 ~ 5965059 (+)
G93541 NA non-coding upstream 729351 5596770 ~ 5660805 (+)
G93437 NA non-coding upstream 897699 5488294 ~ 5492457 (+)
G93713 NA non-coding downstream 190206 6589203 ~ 6589653 (+)
G93758 NA non-coding downstream 437594 6836591 ~ 6836818 (+)
G93790 NA non-coding downstream 477154 6876151 ~ 6876493 (+)
G93791 NA non-coding downstream 480806 6879803 ~ 6880081 (+)
G93820 NA non-coding downstream 575310 6974307 ~ 6975368 (+)
rhpn1 rhpn1 other upstream 8558 6354892 ~ 6381598 (+)
G93638 NA other upstream 176139 6202085 ~ 6214017 (+)
G93613 NA other upstream 338636 6035369 ~ 6051520 (+)
trmt1l trmt1l other upstream 1676923 4685224 ~ 4713233 (+)
LOC120565391 NA other upstream 2076641 4284755 ~ 4313515 (+)
G93938 NA other downstream 950813 7349810 ~ 7350587 (+)
LOC120565294 pycrl other downstream 1479922 7878919 ~ 7890177 (+)
LOC120565614 NA other downstream 1497148 7896145 ~ 7905247 (+)
G94073 rgs5,LOC107393027,LOC104951458,LOC100708109,LOC105932873 other downstream 1838373 8237370 ~ 8286436 (+)
G94199 LOC103367571,LOC102312400,LOC100710958,LOC101467655 other downstream 2748165 9147162 ~ 9168877 (+)

Expression


Co-expression Network