G94231



Basic Information


Item Value
gene id G94231
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053120.1
NCBI id CM020917.1
chromosome length 41568296
location 9540537 ~ 9541059 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU127116
GAGAACGCAGAGTGTGGAGAAACTCCTGTGATTCCAAATGGGAAAGTGGGACCTCCACGAAGGCAAAGCCAAAGGCAAGTCCTAGCTGTGATTATTTGTAACACAGGATACAGCCCTAGGGTTAACTACTTAACTTGTCGCGGGGGAAAATGGACGTCAAATGAAATATCACCCAAAGATATTTGTACACCAACTGCCAAGCTCTGCAACCCCCACCTAAAGTTAAGAATGCATTTGTTCAGACACCTTATCAGATGGAATACTTGTCTGACTCTCCAGTGACTTATCAGTGCCATGATGGCTATGATATGGTGGGAGAAGACACGATTCTATGCAATGATGGGAAATGCGAGGAGAAGAACATAAGATGCACAGGTACGTACAAAATGCATTTCAGAAAGTCACACAGAAGGTTTTTG

Function


GO:

id name namespace
GO:0044421 obsolete extracellular region part cellular_component
GO:0005576 extracellular region cellular_component
GO:0005615 extracellular space cellular_component

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05150 Staphylococcus aureus infection

RNA


RNA id representative length rna type GC content exon number start site end site
TU127116 True 419 lncRNA 0.44 2 9540537 9541059

Neighbor


gene id symbol gene type direction distance location
LOC120566012 NA coding upstream 34610 9406710 ~ 9505927 (+)
LOC120566014 NA coding upstream 67163 9462445 ~ 9473374 (+)
LOC120564889 rgs2,LOC103367537 coding upstream 456680 9080859 ~ 9083857 (+)
LOC120566074 LOC104935955,LOC103367504 coding upstream 469861 9067178 ~ 9070676 (+)
LOC120564878 NA coding upstream 478501 9057341 ~ 9062036 (+)
trnah-gug_12 NA coding downstream 31239 9572298 ~ 9572369 (+)
depdc1a depdc1 coding downstream 34199 9575258 ~ 9587669 (+)
LOC120566020 LOC103374322,LOC104940880,LOC103131468,LOC106964853 coding downstream 48097 9589156 ~ 9603575 (+)
fnbp1l fnbp1l,LOC102783810 coding downstream 73736 9614795 ~ 9671788 (+)
hps3 hps3 coding downstream 225017 9766076 ~ 9785140 (+)
LOC120566016 NA non-coding upstream 45180 9493981 ~ 9495357 (+)
G94232 NA non-coding upstream 54572 9484003 ~ 9485965 (+)
LOC120566015 NA non-coding upstream 102916 9434721 ~ 9437621 (+)
G94201 NA non-coding upstream 370780 9169319 ~ 9169757 (+)
G94192 uchl5 non-coding upstream 444245 9089828 ~ 9096292 (+)
G94238 NA non-coding downstream 6655 9547714 ~ 9551691 (+)
G94259 NA non-coding downstream 121073 9662132 ~ 9679737 (+)
G94266 bcar3,LOC102779191,LOC102207586,LOC101480816 non-coding downstream 150870 9691929 ~ 9693033 (+)
G94373 NA non-coding downstream 360136 9901195 ~ 9902122 (+)
LOC120565916 NA non-coding downstream 367848 9908907 ~ 9912100 (+)
G94199 LOC103367571,LOC102312400,LOC100710958,LOC101467655 other upstream 371660 9147162 ~ 9168877 (+)
G94073 rgs5,LOC107393027,LOC104951458,LOC100708109,LOC105932873 other upstream 1254101 8237370 ~ 8286436 (+)
LOC120565614 NA other upstream 1635290 7896145 ~ 7905247 (+)
LOC120565294 pycrl other upstream 1650360 7878919 ~ 7890177 (+)
G93938 NA other upstream 2189950 7349810 ~ 7350587 (+)
G94239 NA other downstream 11237 9552296 ~ 9557568 (+)
G94281 NA other downstream 276562 9817621 ~ 9879198 (+)
LOC120565620 NA other downstream 303212 9844271 ~ 9846275 (+)
G94376 NA other downstream 361226 9902285 ~ 9903189 (+)
ttc14 ttc14 other downstream 392554 9933613 ~ 9948237 (+)

Expression



Co-expression Network